PAF1 cDNA ORF Clone, Human, C-His tag

Cat: HG16333-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PAF1 Reagents

CRO Services

Product recommended


All PAF1 Reagents

PAF1 cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1596 bp
Description
Full length Clone DNA of Human Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PAF1 cDNA ORF Clone, Human, C-His tag Alternative Names

F23149_1 cDNA ORF Clone, Human;PD2 cDNA ORF Clone, Human

PAF1 Background Information

Full Name
PAF1 homolog, Paf1/RNA polymerase II complex component

PAF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PAF1 cDNA ORF Clone in Cloning Vector, Mouse MG53169-G
PAF1 cDNA ORF Clone, Mouse, untagged MG53169-UT
PAF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53169-ACGLN
PAF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53169-ACG
PAF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53169-ANG
PAF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53169-ACR
PAF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53169-ANR
PAF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53169-CF
PAF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53169-NF
PAF1 cDNA ORF Clone, Mouse, C-His tag MG53169-CH
PAF1 cDNA ORF Clone, Mouse, N-His tag MG53169-NH
PAF1 cDNA ORF Clone, Mouse, C-HA tag MG53169-CY
PAF1 cDNA ORF Clone, Mouse, N-HA tag MG53169-NY
PAF1 cDNA ORF Clone, Mouse, C-Myc tag MG53169-CM
PAF1 cDNA ORF Clone, Mouse, N-Myc tag MG53169-NM

PAF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PAF1 cDNA ORF Clone in Cloning Vector, Human HG16333-G
PAF1 cDNA ORF Clone, Human, untagged HG16333-UT
PAF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16333-ACG
PAF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16333-ACGLN
PAF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16333-ANG
PAF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16333-ACR
PAF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16333-ANR
PAF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16333-CF
PAF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16333-NF
PAF1 cDNA ORF Clone, Human, N-His tag HG16333-NH
PAF1 cDNA ORF Clone, Human, C-HA tag HG16333-CY
PAF1 cDNA ORF Clone, Human, N-HA tag HG16333-NY
PAF1 cDNA ORF Clone, Human, C-Myc tag HG16333-CM
PAF1 cDNA ORF Clone, Human, N-Myc tag HG16333-NM
PAF1 qPCR Primer Pairs, Human HP105086
info info
添加购物车成功! 添加购物车失败!