OSGIN1 cDNA ORF Clone, Human, N-HA tag

Cat: HG15788-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All OSGIN1 Reagents
CRO Services
Product recommended

All OSGIN1 Reagents
OSGIN1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1434 bp
Description
Full length Clone DNA of Human oxidative stress induced growth inhibitor 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OSGIN1 cDNA ORF Clone, Human, N-HA tag Alternative Names
BDGI cDNA ORF Clone, Human;OKL38 cDNA ORF Clone, Human
OSGIN1 Background Information
Full Name
oxidative stress induced growth inhibitor 1

OSGIN1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
OSGIN1 cDNA ORF Clone in Cloning Vector, Rat RG81394-G

OSGIN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
OSGIN1 cDNA ORF Clone in Cloning Vector, Mouse MG53263-U
OSGIN1 cDNA ORF Clone, Mouse, untagged MG53263-UT
OSGIN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53263-ACGLN
OSGIN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53263-ACG
OSGIN1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53263-ANG
OSGIN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53263-ACR
OSGIN1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53263-ANR
OSGIN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53263-CF
OSGIN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53263-NF
OSGIN1 cDNA ORF Clone, Mouse, C-His tag MG53263-CH
OSGIN1 cDNA ORF Clone, Mouse, N-His tag MG53263-NH
OSGIN1 cDNA ORF Clone, Mouse, C-HA tag MG53263-CY
OSGIN1 cDNA ORF Clone, Mouse, N-HA tag MG53263-NY
OSGIN1 cDNA ORF Clone, Mouse, C-Myc tag MG53263-CM
OSGIN1 cDNA ORF Clone, Mouse, N-Myc tag MG53263-NM

OSGIN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
OSGIN1 cDNA ORF Clone in Cloning Vector, Human HG15788-G
OSGIN1 cDNA ORF Clone, Human, untagged HG15788-UT
OSGIN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15788-ACG
OSGIN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15788-ACGLN
OSGIN1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15788-ANG
OSGIN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15788-ACR
OSGIN1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15788-ANR
OSGIN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15788-CF
OSGIN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15788-NF
OSGIN1 cDNA ORF Clone, Human, C-His tag HG15788-CH
OSGIN1 cDNA ORF Clone, Human, N-His tag HG15788-NH
OSGIN1 cDNA ORF Clone, Human, C-HA tag HG15788-CY
OSGIN1 cDNA ORF Clone, Human, C-Myc tag HG15788-CM
OSGIN1 cDNA ORF Clone, Human, N-Myc tag HG15788-NM
OSGIN1 qPCR Primer Pairs, Human HP104379
info info
添加购物车成功! 添加购物车失败!