METTL11A cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG11222-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All METTL11A Reagents
CRO Services
Product recommended

All METTL11A Reagents
METTL11A cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
672 bp
Description
Full length Clone DNA of Human N-terminal Xaa-Pro-Lys N-methyltransferase 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

METTL11A cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
AD-003 cDNA ORF Clone, Human;C9orf32 cDNA ORF Clone, Human;HOMT1A cDNA ORF Clone, Human;METTL11A cDNA ORF Clone, Human;NRMT cDNA ORF Clone, Human;NTM1A cDNA ORF Clone, Human
METTL11A Background Information

Methyltransferase-like protein 11A, also known as METTL11A, is a member of the methyltransferase superfamily and METTL11 family. Methyltransferase is a type of transferase enzyme which transfers a methyl group from a donor to an acceptor. Methylation often occurs on nucleic bases in DNA or amino acids in protein structures. Methytransferase uses a reactive methyl group bound to sulfur in S-adenosyl methionine (SAM) as the methyl donor. DNA methylation is often utilized to silence and regulate genes without changing the original DNA sequence. This methylation occurs on cytosine residues. DNA methylation may be necessary for normal growth from embryonic stages in mammals. Methylation can serve to protect DNA from enzymatic cleavage, since restriction enzymes are unable to bind and recognize externally modified sequences. This is especially useful in bacterial restriction modification systems which use restriction enzymes to cleave foreign DNA while keeping their own DNA protected by methylation. Methylation of amino acids in the formation of proteins leads to more diversity of possible amino acids and therefore more diversity of function. The methylation reaction occurs on nitrogen atoms either on the N terminus or side-chain position of the protein and are usually irreversible.

Full Name
N-terminal Xaa-Pro-Lys N-methyltransferase 1
References
  • Hu R.-M., et al.,(2000), Gene expression profiling in the human hypothalamus-pituitary-adrenal axis and full-length cDNA cloning. Proc. Natl. Acad. Sci. U.S.A. 97:9543-9548.
  • Ota T., et al., (2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
  • Humphray S.J., et al.,(2004), DNA sequence and analysis of human chromosome 9.Nature 429:369-374.
  • METTL11A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    METTL11A cDNA ORF Clone, Mouse, untagged MG5A5666-UT
    METTL11A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5666-ACGLN
    METTL11A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5666-ACG
    METTL11A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5666-ANG
    METTL11A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5666-ACR
    METTL11A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5666-ANR
    METTL11A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5666-CF
    METTL11A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5666-NF
    METTL11A cDNA ORF Clone, Mouse, C-His tag MG5A5666-CH
    METTL11A cDNA ORF Clone, Mouse, N-His tag MG5A5666-NH
    METTL11A cDNA ORF Clone, Mouse, C-HA tag MG5A5666-CY
    METTL11A cDNA ORF Clone, Mouse, N-HA tag MG5A5666-NY
    METTL11A cDNA ORF Clone, Mouse, C-Myc tag MG5A5666-CM
    METTL11A cDNA ORF Clone, Mouse, N-Myc tag MG5A5666-NM

    METTL11A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    METTL11A cDNA ORF Clone in Cloning Vector, Human HG11222-M
    METTL11A cDNA ORF Clone, Human, untagged HG11222-UT
    METTL11A cDNA ORF Clone, Human, C-GFPSpark® tag HG11222-ACG
    METTL11A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11222-ACGLN
    METTL11A cDNA ORF Clone, Human, N-GFPSpark® tag HG11222-ANG
    METTL11A cDNA ORF Clone, Human, C-OFPSpark® tag HG11222-ACR
    METTL11A cDNA ORF Clone, Human, N-OFPSpark® tag HG11222-ANR
    METTL11A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11222-CF
    METTL11A cDNA ORF Clone, Human, C-His tag HG11222-CH
    METTL11A cDNA ORF Clone, Human, N-His tag HG11222-NH
    METTL11A cDNA ORF Clone, Human, C-HA tag HG11222-CY
    METTL11A cDNA ORF Clone, Human, N-HA tag HG11222-NY
    METTL11A cDNA ORF Clone, Human, C-Myc tag HG11222-CM
    METTL11A cDNA ORF Clone, Human, N-Myc tag HG11222-NM
    METTL11A qPCR Primer Pairs, Human HP101123
    info info
    添加购物车成功! 添加购物车失败!