NRAS cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG12073-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NRAS Reagents
CRO Services
Product recommended

All NRAS Reagents
NRAS cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
654 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human neuroblastoma RAS viral (v-ras) oncogene homolog with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + XbaI(6kb+0.65kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
NRAS cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NRAS cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614
Human NRAS / N-Ras Gene Expression validated Image 16648
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
NRAS cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
ALPS4 cDNA ORF Clone, Human;CMNS cDNA ORF Clone, Human;N-ras cDNA ORF Clone, Human;NCMS cDNA ORF Clone, Human;NRAS1 cDNA ORF Clone, Human;NS6 cDNA ORF Clone, Human
NRAS Background Information

NRAS was discovered by researchers at the Institute of Cancer Research, funded by the Cancer Research Campaign (now Cancer Research UK). NRAS gene is a member of the Ras gene family. It is mapped on chromosome 1, and it is activated in HL60, a promyelocytic leukemia line. The mammalian ras gene family consists of the harvey and kirsten ras genes (HRAS and KRAS), an inactive pseudogene of each (c-Hras2 and c-Kras1) and the N-ras gene. They differ significantly only in the C-terminal 40 amino acids. These ras genes have GTP/GDP binding and GTPase activity, and their normal function may be as G-like regulatory proteins involved in the normal control of cell growth. The NRAS gene specifies two main transcripts of 2Kb and 4.3Kb. The difference between the two transcripts is a simple extension through the termination site of the 2Kb transcript. The NRAS gene consists of seven exons (-I, I, II, III, IV, V, VI).

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
neuroblastoma RAS viral (v-ras) oncogene homolog
References
  • Marshall CJ. et al., 1982, Nature. 299 (5879): 171-3.
  • Hall Alan. et al., 1983, Nature. 303 (5916): 396-400.
  • McCormick F. 1996, Mol Reprod Dev. 42 (4): 500-6.
  • NRAS cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    NRAS cDNA ORF Clone in Cloning Vector, Rat RG80678-U
    NRAS cDNA ORF Clone, Rat, untagged RG80678-UT
    NRAS cDNA ORF Clone, Rat, C-GFPSpark® tag RG80678-ACG
    NRAS Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80678-ACGLN
    NRAS cDNA ORF Clone, Rat, C-OFPSpark® tag RG80678-ACR
    NRAS cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80678-CF
    NRAS cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80678-NF
    NRAS cDNA ORF Clone, Rat, C-His tag RG80678-CH
    NRAS cDNA ORF Clone, Rat, N-His tag RG80678-NH
    NRAS cDNA ORF Clone, Rat, C-HA tag RG80678-CY
    NRAS cDNA ORF Clone, Rat, N-HA tag RG80678-NY
    NRAS cDNA ORF Clone, Rat, C-Myc tag RG80678-CM
    NRAS cDNA ORF Clone, Rat, N-Myc tag RG80678-NM
    NRAS qPCR Primer Pairs, Rat RP300642

    NRAS cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    NRAS cDNA ORF Clone in Cloning Vector, Human HG12073-G
    NRAS cDNA ORF Clone, Human, untagged HG12073-UT
    NRAS cDNA ORF Clone, Human, C-GFPSpark® tag HG12073-ACG
    NRAS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12073-ACGLN
    NRAS cDNA ORF Clone, Human, C-OFPSpark® tag HG12073-ACR
    NRAS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12073-CF
    NRAS cDNA ORF Clone, Human, C-His tag HG12073-CH
    NRAS cDNA ORF Clone, Human, N-His tag HG12073-NH
    NRAS cDNA ORF Clone, Human, C-HA tag HG12073-CY
    NRAS cDNA ORF Clone, Human, N-HA tag HG12073-NY
    NRAS cDNA ORF Clone, Human, C-Myc tag HG12073-CM
    NRAS cDNA ORF Clone, Human, N-Myc tag HG12073-NM
    NRAS qPCR Primer Pairs, Human HP101602
    info info
    添加购物车成功! 添加购物车失败!