NR0B2 cDNA ORF Clone, Human, N-HA tag

Cat: HG14043-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All NR0B2 Reagents

CRO Services

Product recommended


All NR0B2 Reagents

NR0B2 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
774 bp
Description
Full length Clone DNA of Human nuclear receptor subfamily 0, group B, member 2 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NR0B2 cDNA ORF Clone, Human, N-HA tag Alternative Names

SHP cDNA ORF Clone, Human;SHP1 cDNA ORF Clone, Human

NR0B2 Background Information

Full Name
nuclear receptor subfamily 0, group B, member 2

NR0B2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NR0B2 cDNA ORF Clone in Cloning Vector, Mouse MG50430-M
NR0B2 cDNA ORF Clone, Mouse, untagged MG50430-UT
NR0B2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50430-ACG
NR0B2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50430-ACGLN
NR0B2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50430-ANG
NR0B2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50430-ACR
NR0B2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50430-ANR
NR0B2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50430-CF
NR0B2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50430-NF
NR0B2 cDNA ORF Clone, Mouse, C-His tag MG50430-CH
NR0B2 cDNA ORF Clone, Mouse, N-His tag MG50430-NH
NR0B2 cDNA ORF Clone, Mouse, C-HA tag MG50430-CY
NR0B2 cDNA ORF Clone, Mouse, N-HA tag MG50430-NY
NR0B2 cDNA ORF Clone, Mouse, C-Myc tag MG50430-CM
NR0B2 cDNA ORF Clone, Mouse, N-Myc tag MG50430-NM
NR0B2 qPCR Primer Pairs, Mouse MP200440

NR0B2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NR0B2 cDNA ORF Clone in Cloning Vector, Human HG14043-G
NR0B2 cDNA ORF Clone, Human, untagged HG14043-UT
NR0B2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14043-ACG
NR0B2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14043-ACGLN
NR0B2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14043-ANG
NR0B2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14043-ACR
NR0B2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14043-ANR
NR0B2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14043-CF
NR0B2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14043-NF
NR0B2 cDNA ORF Clone, Human, C-His tag HG14043-CH
NR0B2 cDNA ORF Clone, Human, N-His tag HG14043-NH
NR0B2 cDNA ORF Clone, Human, C-HA tag HG14043-CY
NR0B2 cDNA ORF Clone, Human, C-Myc tag HG14043-CM
NR0B2 cDNA ORF Clone, Human, N-Myc tag HG14043-NM
NR0B2 qPCR Primer Pairs, Human HP102699
info info
添加购物车成功! 添加购物车失败!