NQO1 cDNA ORF Clone, Human, C-His tag

Cat: HG12046-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NQO1 Reagents
CRO Services
Product recommended

All NQO1 Reagents
NQO1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
825 bp
Description
Full length Clone DNA of Human NAD(P)H dehydrogenase, quinone 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NQO1 cDNA ORF Clone, Human, C-His tag Alternative Names
DHQU cDNA ORF Clone, Human;DIA4 cDNA ORF Clone, Human;DTD cDNA ORF Clone, Human;NMOR1 cDNA ORF Clone, Human;NMORI cDNA ORF Clone, Human;QR1 cDNA ORF Clone, Human
NQO1 Background Information

NQO1 gene is a member of the NAD(P)H dehydrogenase (quinone) family and encodes a cytoplasmic 2-electron reductase. NQO1 forms homodimers and reduces quinones to hydroquinones. NQO1's enzymatic activity prevents the one electron reduction of quinones that results in the production of radical species. Mutations in NQO1 gene have been associated with tardive dyskinesia (TD), an increased risk of hematotoxicity after exposure to benzene, and susceptibility to various forms of cancer. Altered expression of NQO1 has been seen in many tumors and is also associated with Alzheimer's disease (AD). Alternate transcriptional splice variants, encoding different isoforms, have been characterized. Recent pharmacological research suggests feasibility of genotype-directed redox chemotherapeutic intervention targeting NQO1 breast cancer, a common missense genotype encoding a functionally impaired NQO1 protein.

Full Name
NAD(P)H dehydrogenase, quinone 1
References
  • Ross David. et al., 2002, J Biol Chem. 277 (16): 14060-7.
  • Cabello CM. et al., 2010, Free Radic Res. 45 (3): 276-92.
  • Adesnik M. et al., 1988, J Biol Chem. 263 (27): 13572-8.
  • NQO1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    NQO1 cDNA ORF Clone in Cloning Vector, Rat RG81947-U
    NQO1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81947-ACGLN

    NQO1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    NQO1 cDNA ORF Clone in Cloning Vector, Mouse MG57522-U
    NQO1 cDNA ORF Clone, Mouse, untagged MG57522-UT
    NQO1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57522-ACG
    NQO1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57522-ACGLN
    NQO1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57522-ANG
    NQO1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57522-ACR
    NQO1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57522-ANR
    NQO1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57522-CF
    NQO1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57522-NF
    NQO1 cDNA ORF Clone, Mouse, C-His tag MG57522-CH
    NQO1 cDNA ORF Clone, Mouse, N-His tag MG57522-NH
    NQO1 cDNA ORF Clone, Mouse, C-HA tag MG57522-CY
    NQO1 cDNA ORF Clone, Mouse, N-HA tag MG57522-NY
    NQO1 cDNA ORF Clone, Mouse, C-Myc tag MG57522-CM
    NQO1 cDNA ORF Clone, Mouse, N-Myc tag MG57522-NM

    NQO1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    NQO1 cDNA ORF Clone in Cloning Vector, Human HG12046-G
    NQO1 cDNA ORF Clone, Human, untagged HG12046-UT
    NQO1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12046-ACG
    NQO1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12046-ACGLN
    NQO1 cDNA ORF Clone, Human, N-GFPSpark® tag HG12046-ANG
    NQO1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12046-ACR
    NQO1 cDNA ORF Clone, Human, N-OFPSpark® tag HG12046-ANR
    NQO1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12046-CF
    NQO1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12046-NF
    NQO1 cDNA ORF Clone, Human, N-His tag HG12046-NH
    NQO1 cDNA ORF Clone, Human, C-HA tag HG12046-CY
    NQO1 cDNA ORF Clone, Human, N-HA tag HG12046-NY
    NQO1 cDNA ORF Clone, Human, C-Myc tag HG12046-CM
    NQO1 cDNA ORF Clone, Human, N-Myc tag HG12046-NM
    NQO1 qPCR Primer Pairs, Human HP101580
    info info
    添加购物车成功! 添加购物车失败!