NOSIP cDNA ORF Clone, Human, C-HA tag

Cat: HG14060-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NOSIP Reagents
CRO Services
Product recommended

All NOSIP Reagents
NOSIP cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
906 bp
Description
Full length Clone DNA of Human nitric oxide synthase interacting protein with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NOSIP cDNA ORF Clone, Human, C-HA tag Alternative Names
CGI-25 cDNA ORF Clone, Human
NOSIP Background Information
Full Name
nitric oxide synthase interacting protein

NOSIP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NOSIP cDNA ORF Clone in Cloning Vector, Mouse MG53441-G
NOSIP cDNA ORF Clone, Mouse, untagged MG53441-UT
NOSIP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53441-ACGLN
NOSIP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53441-ACG
NOSIP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53441-ANG
NOSIP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53441-ACR
NOSIP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53441-ANR
NOSIP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53441-CF
NOSIP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53441-NF
NOSIP cDNA ORF Clone, Mouse, C-His tag MG53441-CH
NOSIP cDNA ORF Clone, Mouse, N-His tag MG53441-NH
NOSIP cDNA ORF Clone, Mouse, C-HA tag MG53441-CY
NOSIP cDNA ORF Clone, Mouse, N-HA tag MG53441-NY
NOSIP cDNA ORF Clone, Mouse, C-Myc tag MG53441-CM
NOSIP cDNA ORF Clone, Mouse, N-Myc tag MG53441-NM

NOSIP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NOSIP cDNA ORF Clone in Cloning Vector, Human HG14060-G
NOSIP cDNA ORF Clone, Human, untagged HG14060-UT
NOSIP cDNA ORF Clone, Human, C-GFPSpark® tag HG14060-ACG
NOSIP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14060-ACGLN
NOSIP cDNA ORF Clone, Human, N-GFPSpark® tag HG14060-ANG
NOSIP cDNA ORF Clone, Human, C-OFPSpark® tag HG14060-ACR
NOSIP cDNA ORF Clone, Human, N-OFPSpark® tag HG14060-ANR
NOSIP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14060-CF
NOSIP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14060-NF
NOSIP cDNA ORF Clone, Human, C-His tag HG14060-CH
NOSIP cDNA ORF Clone, Human, N-His tag HG14060-NH
NOSIP cDNA ORF Clone, Human, N-HA tag HG14060-NY
NOSIP cDNA ORF Clone, Human, C-Myc tag HG14060-CM
NOSIP cDNA ORF Clone, Human, N-Myc tag HG14060-NM
NOSIP qPCR Primer Pairs, Human HP102716
info info
添加购物车成功! 添加购物车失败!