NEGR1 cDNA ORF Clone, Human, untagged

Cat: HG11181-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All NEGR1 Reagents

CRO Services

Product recommended


All NEGR1 Reagents

NEGR1 cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1065 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 888C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human neuronal growth regulator 1.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6.1kb + 1.07kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

NEGR1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NEGR1 cDNA ORF Clone, Human, untagged Alternative Names

DMML2433 cDNA ORF Clone, Human;IGLON4 cDNA ORF Clone, Human;KILON cDNA ORF Clone, Human;Ntra cDNA ORF Clone, Human

NEGR1 Background Information

Neuronal Growth Regulator 1, NEGR1, also known as neurotractin, or KILON, which belongs to the immunoglobulin superfamily, IgLON family. This GPI-linked cell surface glycoprotein NEGR1 is composed of three Ig-like domains and belongs to the IgLON subgroup of neural IgSF members. It is expressed in two isoforms with apparent molecular masses of 50 and 37 kD, termed L-form and S-form, respectively. NEGR1/Neurotractin participates in the regulation of neurite outgrowth in the developing brain, and is expressed on neurites of primary hippocampal neurons. Neurotractin/KILON is a trans-neural growth-promoting factor for outgrowing axons following hippocampal denervation. KILON (kindred of IgLON) and opioid-binding cell adhesion molecule belong to the IgLON subgroup of immunoglobulin superfamily together with the limbic system-associated membrane protein and neurotrimin. The alteration of modulatory function of KILON/NEGR1 for the number of dendritic synapses concomitant with changes in its localization and detergent solubility during neuronal culture development. In addition to its reported role in the brain, NEGR1 is also expressed in subcutaneous adipose tissue and acts as a central 'hub' in an obesity-related transcript network.

Full Name
neuronal growth regulator 1
References
  • Marg A, et al. (1999) Neurotractin, a novel neurite outgrowth-promoting Ig-like protein that interacts with CEPU-1 and LAMP. J Cell Biol. 145(4): 865-76.
  • Miyata S, et al. (2003) Biochemical and ultrastructural analyses of IgLON cell adhesion molecules, Kilon and OBCAM in the rat brain. Neuroscience. 117(3): 645-58.
  • Schfer M, et al. (2005) Neurotractin/kilon promotes neurite outgrowth and is expressed on reactive astrocytes after entorhinal cortex lesion. Mol Cell Neurosci. 29(4): 580-90.
  • Hashimoto T, et al. (2008) IgLON cell adhesion molecule Kilon is a crucial modulator for synapse number in hippocampal neurons. Brain Res. 1224: 1-11.
  • NEGR1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    NEGR1 cDNA ORF Clone in Cloning Vector, Mouse MG50601-M
    NEGR1 cDNA ORF Clone, Mouse, untagged MG50601-UT
    NEGR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50601-ACGLN
    NEGR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50601-ACG
    NEGR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50601-ACR
    NEGR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50601-CF
    NEGR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50601-NF
    NEGR1 cDNA ORF Clone, Mouse, C-His tag MG50601-CH
    NEGR1 cDNA ORF Clone, Mouse, N-His tag MG50601-NH
    NEGR1 cDNA ORF Clone, Mouse, C-HA tag MG50601-CY
    NEGR1 cDNA ORF Clone, Mouse, N-HA tag MG50601-NY
    NEGR1 cDNA ORF Clone, Mouse, C-Myc tag MG50601-CM
    NEGR1 cDNA ORF Clone, Mouse, N-Myc tag MG50601-NM
    NEGR1 qPCR Primer Pairs, Mouse MP200587

    NEGR1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    NEGR1 cDNA ORF Clone in Cloning Vector, Human HG11181-M
    NEGR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11181-ACG
    NEGR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11181-ACGLN
    NEGR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11181-ACR
    NEGR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11181-CF
    NEGR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11181-NF
    NEGR1 cDNA ORF Clone, Human, C-His tag HG11181-CH
    NEGR1 cDNA ORF Clone, Human, N-His tag HG11181-NH
    NEGR1 cDNA ORF Clone, Human, C-HA tag HG11181-CY
    NEGR1 cDNA ORF Clone, Human, N-HA tag HG11181-NY
    NEGR1 cDNA ORF Clone, Human, C-Myc tag HG11181-CM
    NEGR1 cDNA ORF Clone, Human, N-Myc tag HG11181-NM
    NEGR1 qPCR Primer Pairs, Human HP101087
    info info
    添加购物车成功! 添加购物车失败!