NDUFS3 cDNA ORF Clone, Human, N-HA tag

Cat: HG16412-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All NDUFS3 Reagents

CRO Services

Product recommended


All NDUFS3 Reagents

NDUFS3 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
795 bp
Description
Full length Clone DNA of Human NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase) with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NDUFS3 cDNA ORF Clone, Human, N-HA tag Alternative Names

CI-30 cDNA ORF Clone, Human

NDUFS3 Background Information

Full Name
NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)

NDUFS3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NDUFS3 cDNA ORF Clone in Cloning Vector, Rat RG85745-U
NDUFS3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85745-ACGLN

NDUFS3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NDUFS3 cDNA ORF Clone in Cloning Vector, Mouse MG51333-U
NDUFS3 cDNA ORF Clone, Mouse, untagged MG51333-UT
NDUFS3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51333-ACG
NDUFS3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51333-ACGLN
NDUFS3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51333-ANG
NDUFS3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51333-ACR
NDUFS3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51333-ANR
NDUFS3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51333-CF
NDUFS3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51333-NF
NDUFS3 cDNA ORF Clone, Mouse, C-His tag MG51333-CH
NDUFS3 cDNA ORF Clone, Mouse, N-His tag MG51333-NH
NDUFS3 cDNA ORF Clone, Mouse, C-HA tag MG51333-CY
NDUFS3 cDNA ORF Clone, Mouse, N-HA tag MG51333-NY
NDUFS3 cDNA ORF Clone, Mouse, C-Myc tag MG51333-CM
NDUFS3 cDNA ORF Clone, Mouse, N-Myc tag MG51333-NM
NDUFS3 qPCR Primer Pairs, Mouse MP201210

NDUFS3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NDUFS3 cDNA ORF Clone in Cloning Vector, Human HG16412-G
NDUFS3 cDNA ORF Clone, Human, untagged HG16412-UT
NDUFS3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16412-ACG
NDUFS3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16412-ACGLN
NDUFS3 cDNA ORF Clone, Human, N-GFPSpark® tag HG16412-ANG
NDUFS3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16412-ACR
NDUFS3 cDNA ORF Clone, Human, N-OFPSpark® tag HG16412-ANR
NDUFS3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16412-CF
NDUFS3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16412-NF
NDUFS3 cDNA ORF Clone, Human, C-His tag HG16412-CH
NDUFS3 cDNA ORF Clone, Human, N-His tag HG16412-NH
NDUFS3 cDNA ORF Clone, Human, C-HA tag HG16412-CY
NDUFS3 cDNA ORF Clone, Human, C-Myc tag HG16412-CM
NDUFS3 cDNA ORF Clone, Human, N-Myc tag HG16412-NM
NDUFS3 qPCR Primer Pairs, Human HP105161
info info
添加购物车成功! 添加购物车失败!