MTMR6 cDNA ORF Clone, Human, N-HA tag

Cat: HG15192-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All MTMR6 Reagents

CRO Services

Product recommended


All MTMR6 Reagents

MTMR6 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1908 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human myotubularin related protein 6 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.91kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MTMR6 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MTMR6 cDNA ORF Clone, Human, N-HA tag Validated Images

Cynomolgus LOC101926731 Gene Plasmid Map 5628

MTMR6 Background Information

Full Name
myotubularin related protein 6

MTMR6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MTMR6 cDNA ORF Clone in Cloning Vector, Rat RG8A3389-U
MTMR6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A3389-ACGLN

MTMR6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MTMR6 cDNA ORF Clone in Cloning Vector, Mouse MG5A5214-U
MTMR6 cDNA ORF Clone, Mouse, untagged MG5A5214-UT
MTMR6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5214-ACG
MTMR6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5214-ACGLN
MTMR6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5214-ANG
MTMR6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5214-ACR
MTMR6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5214-ANR
MTMR6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5214-CF
MTMR6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5214-NF
MTMR6 cDNA ORF Clone, Mouse, C-His tag MG5A5214-CH
MTMR6 cDNA ORF Clone, Mouse, N-His tag MG5A5214-NH
MTMR6 cDNA ORF Clone, Mouse, C-HA tag MG5A5214-CY
MTMR6 cDNA ORF Clone, Mouse, N-HA tag MG5A5214-NY
MTMR6 cDNA ORF Clone, Mouse, C-Myc tag MG5A5214-CM
MTMR6 cDNA ORF Clone, Mouse, N-Myc tag MG5A5214-NM

MTMR6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MTMR6 cDNA ORF Clone in Cloning Vector, Human HG15192-G
MTMR6 cDNA ORF Clone, Human, untagged HG15192-UT
MTMR6 cDNA ORF Clone, Human, C-GFPSpark® tag HG15192-ACG
MTMR6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15192-ACGLN
MTMR6 cDNA ORF Clone, Human, N-GFPSpark® tag HG15192-ANG
MTMR6 cDNA ORF Clone, Human, C-OFPSpark® tag HG15192-ACR
MTMR6 cDNA ORF Clone, Human, N-OFPSpark® tag HG15192-ANR
MTMR6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15192-CF
MTMR6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15192-NF
MTMR6 cDNA ORF Clone, Human, C-His tag HG15192-CH
MTMR6 cDNA ORF Clone, Human, N-His tag HG15192-NH
MTMR6 cDNA ORF Clone, Human, C-HA tag HG15192-CY
MTMR6 cDNA ORF Clone, Human, C-Myc tag HG15192-CM
MTMR6 cDNA ORF Clone, Human, N-Myc tag HG15192-NM
MTMR6 qPCR Primer Pairs, Human HP103818
info info
添加购物车成功! 添加购物车失败!