MRPL3 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG16288-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MRPL3 Reagents

CRO Services

Product recommended


All MRPL3 Reagents

MRPL3 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1047 bp
Description
Full length Clone DNA of Human mitochondrial ribosomal protein L3 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRPL3 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

COXPD9 cDNA ORF Clone, Human;MRL3 cDNA ORF Clone, Human;RPML3 cDNA ORF Clone, Human

MRPL3 Background Information

Full Name
mitochondrial ribosomal protein L3

MRPL3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRPL3 cDNA ORF Clone in Cloning Vector, Mouse MG51439-G
MRPL3 cDNA ORF Clone, Mouse, untagged MG51439-UT
MRPL3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51439-ACGLN
MRPL3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51439-ACG
MRPL3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51439-ANG
MRPL3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51439-ACR
MRPL3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51439-ANR
MRPL3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51439-CF
MRPL3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51439-NF
MRPL3 cDNA ORF Clone, Mouse, C-His tag MG51439-CH
MRPL3 cDNA ORF Clone, Mouse, N-His tag MG51439-NH
MRPL3 cDNA ORF Clone, Mouse, C-HA tag MG51439-CY
MRPL3 cDNA ORF Clone, Mouse, N-HA tag MG51439-NY
MRPL3 cDNA ORF Clone, Mouse, C-Myc tag MG51439-CM
MRPL3 cDNA ORF Clone, Mouse, N-Myc tag MG51439-NM
MRPL3 qPCR Primer Pairs, Mouse MP201323

MRPL3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MRPL3 cDNA ORF Clone in Cloning Vector, Human HG16288-G
MRPL3 cDNA ORF Clone, Human, untagged HG16288-UT
MRPL3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16288-ACGLN
MRPL3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16288-ACG
MRPL3 cDNA ORF Clone, Human, N-GFPSpark® tag HG16288-ANG
MRPL3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16288-ACR
MRPL3 cDNA ORF Clone, Human, N-OFPSpark® tag HG16288-ANR
MRPL3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16288-NF
MRPL3 cDNA ORF Clone, Human, C-His tag HG16288-CH
MRPL3 cDNA ORF Clone, Human, N-His tag HG16288-NH
MRPL3 cDNA ORF Clone, Human, C-HA tag HG16288-CY
MRPL3 cDNA ORF Clone, Human, N-HA tag HG16288-NY
MRPL3 cDNA ORF Clone, Human, C-Myc tag HG16288-CM
MRPL3 cDNA ORF Clone, Human, N-Myc tag HG16288-NM
MRPL3 qPCR Primer Pairs, Human HP105042
info info
添加购物车成功! 添加购物车失败!