MORF4L2 cDNA ORF Clone, Human, untagged

Cat: HG15249-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MORF4L2 Reagents
CRO Services
Product recommended

All MORF4L2 Reagents
MORF4L2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
867 bp
Description
Full length Clone DNA of Human mortality factor 4 like 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MORF4L2 cDNA ORF Clone, Human, untagged Alternative Names
MORFL2 cDNA ORF Clone, Human;MRGX cDNA ORF Clone, Human
MORF4L2 Background Information
Full Name
mortality factor 4 like 2

MORF4L2 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
MORF4L2 cDNA ORF Clone in Cloning Vector, Ferret FG60122-G
MORF4L2 cDNA ORF Clone, Ferret, untagged FG60122-UT
MORF4L2 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60122-ACG
MORF4L2 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60122-ACGLN
MORF4L2 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60122-ANG
MORF4L2 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60122-ACR
MORF4L2 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60122-ANR
MORF4L2 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60122-CF
MORF4L2 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60122-NF
MORF4L2 cDNA ORF Clone, Ferret, C-His tag FG60122-CH
MORF4L2 cDNA ORF Clone, Ferret, N-His tag FG60122-NH
MORF4L2 cDNA ORF Clone, Ferret, C-HA tag FG60122-CY
MORF4L2 cDNA ORF Clone, Ferret, N-HA tag FG60122-NY
MORF4L2 cDNA ORF Clone, Ferret, C-Myc tag FG60122-CM
MORF4L2 cDNA ORF Clone, Ferret, N-Myc tag FG60122-NM

MORF4L2 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
MORF4L2 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90404-G
MORF4L2 cDNA ORF Clone, Cynomolgus, untagged CG90404-UT
MORF4L2 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90404-ACGLN
MORF4L2 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90404-ACG
MORF4L2 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90404-ANG
MORF4L2 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90404-ACR
MORF4L2 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90404-ANR
MORF4L2 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90404-CF
MORF4L2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90404-NF
MORF4L2 cDNA ORF Clone, Cynomolgus, C-His tag CG90404-CH
MORF4L2 cDNA ORF Clone, Cynomolgus, N-His tag CG90404-NH
MORF4L2 cDNA ORF Clone, Cynomolgus, C-HA tag CG90404-CY
MORF4L2 cDNA ORF Clone, Cynomolgus, N-HA tag CG90404-NY
MORF4L2 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90404-CM
MORF4L2 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90404-NM

MORF4L2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MORF4L2 cDNA ORF Clone in Cloning Vector, Rat RG81086-U
MORF4L2 cDNA ORF Clone, Rat, untagged RG81086-UT
MORF4L2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81086-ACG
MORF4L2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81086-ACGLN
MORF4L2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81086-ANG
MORF4L2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81086-ACR
MORF4L2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81086-ANR
MORF4L2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81086-CF
MORF4L2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81086-NF
MORF4L2 cDNA ORF Clone, Rat, C-His tag RG81086-CH
MORF4L2 cDNA ORF Clone, Rat, N-His tag RG81086-NH
MORF4L2 cDNA ORF Clone, Rat, C-HA tag RG81086-CY
MORF4L2 cDNA ORF Clone, Rat, N-HA tag RG81086-NY
MORF4L2 cDNA ORF Clone, Rat, C-Myc tag RG81086-CM
MORF4L2 cDNA ORF Clone, Rat, N-Myc tag RG81086-NM
MORF4L2 qPCR Primer Pairs, Rat RP301043

MORF4L2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MORF4L2 cDNA ORF Clone in Cloning Vector, Mouse MG53002-G
MORF4L2 cDNA ORF Clone, Mouse, untagged MG53002-UT
MORF4L2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53002-ACG
MORF4L2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53002-ACGLN
MORF4L2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53002-ANG
MORF4L2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53002-ACR
MORF4L2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53002-ANR
MORF4L2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53002-CF
MORF4L2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53002-NF
MORF4L2 cDNA ORF Clone, Mouse, C-His tag MG53002-CH
MORF4L2 cDNA ORF Clone, Mouse, N-His tag MG53002-NH
MORF4L2 cDNA ORF Clone, Mouse, C-HA tag MG53002-CY
MORF4L2 cDNA ORF Clone, Mouse, N-HA tag MG53002-NY
MORF4L2 cDNA ORF Clone, Mouse, C-Myc tag MG53002-CM
MORF4L2 cDNA ORF Clone, Mouse, N-Myc tag MG53002-NM

MORF4L2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MORF4L2 cDNA ORF Clone in Cloning Vector, Human HG15249-G
MORF4L2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15249-ACG
MORF4L2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15249-ACGLN
MORF4L2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15249-ANG
MORF4L2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15249-ACR
MORF4L2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15249-ANR
MORF4L2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15249-CF
MORF4L2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15249-NF
MORF4L2 cDNA ORF Clone, Human, C-His tag HG15249-CH
MORF4L2 cDNA ORF Clone, Human, N-His tag HG15249-NH
MORF4L2 cDNA ORF Clone, Human, C-HA tag HG15249-CY
MORF4L2 cDNA ORF Clone, Human, N-HA tag HG15249-NY
MORF4L2 cDNA ORF Clone, Human, C-Myc tag HG15249-CM
MORF4L2 cDNA ORF Clone, Human, N-Myc tag HG15249-NM
MORF4L2 qPCR Primer Pairs, Human HP103875
info info
添加购物车成功! 添加购物车失败!