MMP13 cDNA ORF Clone, Human, C-HA tag

Cat: HG12088-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MMP13 Reagents
CRO Services
Product recommended

All MMP13 Reagents
MMP13 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1416 bp
Description
Full length Clone DNA of Human matrix metallopeptidase 13 (collagenase 3) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MMP13 cDNA ORF Clone, Human, C-HA tag Alternative Names
CLG3 cDNA ORF Clone, Human;MANDP1 cDNA ORF Clone, Human;MMP-13 cDNA ORF Clone, Human
MMP13 Background Information
Full Name
matrix metallopeptidase 13

MMP13 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MMP13 cDNA ORF Clone in Cloning Vector, Rat RG81926-U
MMP13 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81926-ACGLN

MMP13 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MMP13 cDNA ORF Clone in Cloning Vector, Mouse MG57179-U
MMP13 cDNA ORF Clone, Mouse, untagged MG57179-UT
MMP13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57179-ACGLN
MMP13 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57179-ACG
MMP13 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57179-ACR
MMP13 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57179-CF
MMP13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57179-NF
MMP13 cDNA ORF Clone, Mouse, C-His tag MG57179-CH
MMP13 cDNA ORF Clone, Mouse, N-His tag MG57179-NH
MMP13 cDNA ORF Clone, Mouse, C-HA tag MG57179-CY
MMP13 cDNA ORF Clone, Mouse, N-HA tag MG57179-NY
MMP13 cDNA ORF Clone, Mouse, C-Myc tag MG57179-CM
MMP13 cDNA ORF Clone, Mouse, N-Myc tag MG57179-NM

MMP13 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MMP13 cDNA ORF Clone in Cloning Vector, Human HG12088-G
MMP13 cDNA ORF Clone, Human, untagged HG12088-UT
MMP13 cDNA ORF Clone, Human, untagged HG11852-G-N
MMP13 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12088-ACGLN
MMP13 cDNA ORF Clone, Human, C-GFPSpark® tag HG12088-ACG
MMP13 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11852-ACGLN
MMP13 cDNA ORF Clone, Human, C-OFPSpark® tag HG12088-ACR
MMP13 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12088-CF
MMP13 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12088-NF
MMP13 cDNA ORF Clone, Human, C-His tag HG12088-CH
MMP13 cDNA ORF Clone, Human, N-His tag HG12088-NH
MMP13 cDNA ORF Clone, Human, N-HA tag HG12088-NY
MMP13 cDNA ORF Clone, Human, C-Myc tag HG12088-CM
MMP13 cDNA ORF Clone, Human, N-Myc tag HG12088-NM
MMP13 qPCR Primer Pairs, Human HP101616
info info
添加购物车成功! 添加购物车失败!