MIEN1 cDNA ORF Clone, Human, N-HA tag

Cat: HG16410-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MIEN1 Reagents

CRO Services

Product recommended


All MIEN1 Reagents

MIEN1 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
348 bp
Description
Full length Clone DNA of Human migration and invasion enhancer 1 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MIEN1 cDNA ORF Clone, Human, N-HA tag Alternative Names

C17orf37 cDNA ORF Clone, Human;C35 cDNA ORF Clone, Human;ORB3 cDNA ORF Clone, Human;RDX12 cDNA ORF Clone, Human;XTP4 cDNA ORF Clone, Human

MIEN1 Background Information

Full Name
migration and invasion enhancer 1

MIEN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MIEN1 cDNA ORF Clone in Cloning Vector, Mouse MG53742-U
MIEN1 cDNA ORF Clone, Mouse, untagged MG53742-UT
MIEN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53742-ACGLN
MIEN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53742-ACG
MIEN1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53742-ANG
MIEN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53742-ACR
MIEN1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53742-ANR
MIEN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53742-CF
MIEN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53742-NF
MIEN1 cDNA ORF Clone, Mouse, C-His tag MG53742-CH
MIEN1 cDNA ORF Clone, Mouse, N-His tag MG53742-NH
MIEN1 cDNA ORF Clone, Mouse, C-HA tag MG53742-CY
MIEN1 cDNA ORF Clone, Mouse, N-HA tag MG53742-NY
MIEN1 cDNA ORF Clone, Mouse, C-Myc tag MG53742-CM
MIEN1 cDNA ORF Clone, Mouse, N-Myc tag MG53742-NM

MIEN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MIEN1 cDNA ORF Clone in Cloning Vector, Human HG16410-G
MIEN1 cDNA ORF Clone, Human, untagged HG16410-UT
MIEN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16410-ACG
MIEN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16410-ACGLN
MIEN1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16410-ANG
MIEN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16410-ACR
MIEN1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16410-ANR
MIEN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16410-CF
MIEN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16410-NF
MIEN1 cDNA ORF Clone, Human, C-His tag HG16410-CH
MIEN1 cDNA ORF Clone, Human, N-His tag HG16410-NH
MIEN1 cDNA ORF Clone, Human, C-HA tag HG16410-CY
MIEN1 cDNA ORF Clone, Human, C-Myc tag HG16410-CM
MIEN1 cDNA ORF Clone, Human, N-Myc tag HG16410-NM
MIEN1 qPCR Primer Pairs, Human HP105159
info info
添加购物车成功! 添加购物车失败!