MECP2 cDNA ORF Clone, Human, C-His tag

Cat: HG12052-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MECP2 Reagents
CRO Services
Product recommended

All MECP2 Reagents
MECP2 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1461 bp
Description
Full length Clone DNA of Human methyl CpG binding protein 2 (Rett syndrome) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MECP2 cDNA ORF Clone, Human, C-His tag Alternative Names
AUTSX3 cDNA ORF Clone, Human;MRX16 cDNA ORF Clone, Human;MRX79 cDNA ORF Clone, Human;MRXS13 cDNA ORF Clone, Human;MRXSL cDNA ORF Clone, Human;PPMX cDNA ORF Clone, Human;RS cDNA ORF Clone, Human;RTS cDNA ORF Clone, Human;RTT cDNA ORF Clone, Human
MECP2 Background Information
Full Name
methyl CpG binding protein 2

MECP2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MECP2 cDNA ORF Clone in Cloning Vector, Mouse MG53595-U
MECP2 cDNA ORF Clone, Mouse, untagged MG53595-UT
MECP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53595-ACGLN
MECP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53595-ACG
MECP2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53595-ANG
MECP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53595-ACR
MECP2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53595-ANR
MECP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53595-CF
MECP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53595-NF
MECP2 cDNA ORF Clone, Mouse, C-His tag MG53595-CH
MECP2 cDNA ORF Clone, Mouse, N-His tag MG53595-NH
MECP2 cDNA ORF Clone, Mouse, C-HA tag MG53595-CY
MECP2 cDNA ORF Clone, Mouse, N-HA tag MG53595-NY
MECP2 cDNA ORF Clone, Mouse, C-Myc tag MG53595-CM
MECP2 cDNA ORF Clone, Mouse, N-Myc tag MG53595-NM

MECP2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MECP2 cDNA ORF Clone in Cloning Vector, Human HG12052-G
MECP2 cDNA ORF Clone, Human, untagged HG12052-UT
MECP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG12052-ACG
MECP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12052-ACGLN
MECP2 cDNA ORF Clone, Human, N-GFPSpark® tag HG12052-ANG
MECP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG12052-ACR
MECP2 cDNA ORF Clone, Human, N-OFPSpark® tag HG12052-ANR
MECP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12052-CF
MECP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12052-NF
MECP2 cDNA ORF Clone, Human, N-His tag HG12052-NH
MECP2 cDNA ORF Clone, Human, C-HA tag HG12052-CY
MECP2 cDNA ORF Clone, Human, N-HA tag HG12052-NY
MECP2 cDNA ORF Clone, Human, C-Myc tag HG12052-CM
MECP2 cDNA ORF Clone, Human, N-Myc tag HG12052-NM
MECP2 qPCR Primer Pairs, Human HP101584
info info
添加购物车成功! 添加购物车失败!