MCM6 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14317-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MCM6 Reagents
CRO Services
Product recommended

All MCM6 Reagents
MCM6 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2511 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human minichromosome maintenance complex component 6 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Restriction Sites
KpnI + NotI(6kb+2.51kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MCM6 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MCM6 cDNA ORF Clone, Human, N-Myc tag Validated Images
Human MDM2 Gene Plasmid Map 5775
MCM6 cDNA ORF Clone, Human, N-Myc tag Alternative Names
MCG40308 cDNA ORF Clone, Human;Mis5 cDNA ORF Clone, Human;P105MCM cDNA ORF Clone, Human
MCM6 Background Information
Full Name
minichromosome maintenance complex component 6

MCM6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MCM6 cDNA ORF Clone in Cloning Vector, Rat RG80849-U
MCM6 cDNA ORF Clone, Rat, untagged RG80849-UT
MCM6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80849-ACGLN
MCM6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80849-ACG
MCM6 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80849-ANG
MCM6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80849-ACR
MCM6 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80849-ANR
MCM6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80849-CF
MCM6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80849-NF
MCM6 cDNA ORF Clone, Rat, C-His tag RG80849-CH
MCM6 cDNA ORF Clone, Rat, N-His tag RG80849-NH
MCM6 cDNA ORF Clone, Rat, C-HA tag RG80849-CY
MCM6 cDNA ORF Clone, Rat, N-HA tag RG80849-NY
MCM6 cDNA ORF Clone, Rat, C-Myc tag RG80849-CM
MCM6 cDNA ORF Clone, Rat, N-Myc tag RG80849-NM
MCM6 qPCR Primer Pairs, Rat RP300813

MCM6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MCM6 cDNA ORF Clone in Cloning Vector, Human HG14317-G
MCM6 cDNA ORF Clone, Human, untagged HG14317-UT
MCM6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14317-ACGLN
MCM6 cDNA ORF Clone, Human, C-GFPSpark® tag HG14317-ACG
MCM6 cDNA ORF Clone, Human, N-GFPSpark® tag HG14317-ANG
MCM6 cDNA ORF Clone, Human, C-OFPSpark® tag HG14317-ACR
MCM6 cDNA ORF Clone, Human, N-OFPSpark® tag HG14317-ANR
MCM6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14317-CF
MCM6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14317-NF
MCM6 cDNA ORF Clone, Human, C-His tag HG14317-CH
MCM6 cDNA ORF Clone, Human, N-His tag HG14317-NH
MCM6 cDNA ORF Clone, Human, C-HA tag HG14317-CY
MCM6 cDNA ORF Clone, Human, N-HA tag HG14317-NY
MCM6 cDNA ORF Clone, Human, C-Myc tag HG14317-CM
MCM6 qPCR Primer Pairs, Human HP102967
info info
添加购物车成功! 添加购物车失败!