Lumican cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11640-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Lumican Reagents
CRO Services
Product recommended

All Lumican Reagents
Lumican cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1017 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human lumican with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI (two restriction sites) + NotI (6kb+1.02kb+0.05kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Lumican cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Lumican cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human Lumican Gene Expression validated Image 1836
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Human Lumican Gene Plasmid Map 5803
Lumican cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
LDC cDNA ORF Clone, Human;SLRR2D cDNA ORF Clone, Human
Lumican Background Information

Lumican, a prototypic leucine-rich proteoglycan with keratan sulfate side chains, is a major component of the cornea, dermal, and muscle connective tissues. In these bifunctional molecules, the protein moiety binds collagen fibrils and the highly charged hydrophilic glycosaminoglycans regulate interfibrillar spacings. Lumican is the major keratan sulfate proteoglycan of the cornea but is also distributed in interstitial collagenous matrices throughout the body. Lumican regulates collagenous matrix assembly as a keratan sulfate proteoglycan in the cornea and is also present in the connective tissues of other organs and embryonic corneal stroma as a glycoprotein. Lumican may regulate collagen fibril organization and circumferential growth, corneal transparency, and epithelial cell migration and tissue repair. lumican expressed in injured epithelium may modulate cell behavior such as adhesion or migration, thus contributing to corneal epithelial wound healing. Lumican plays a crucial role in the regulation of collagen assembly into fibrils in various connective tissues and serve as a definitive link between a necessity for lumican in the development of a highly organized collagenous matrix and corneal transparency.

Full Name
lumican
References
  • Saika S, et al. (2000) Role of lumican in the corneal epithelium during wound healing. J Biol Chem. 275(4): 2607-12.
  • Chakravarti S, et al. (1998) Lumican regulates collagen fibril assembly: skin fragility and corneal opacity in the absence of lumican. J Cell Biol. 141(5): 1277-86.
  • Ezura Y, et al. (2000) Differential expression of lumican and fibromodulin regulate collagen fibrillogenesis in developing mouse tendons. J Cell Biol. 151(4): 779-88.
  • Lumican cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Lumican cDNA ORF Clone in Cloning Vector, Rat RG83029-U
    Lumican Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83029-ACGLN

    Lumican cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Lumican cDNA ORF Clone in Cloning Vector, Mouse MG57964-U
    Lumican cDNA ORF Clone, Mouse, untagged MG57964-UT
    Lumican cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57964-ACG
    Lumican Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57964-ACGLN
    Lumican cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57964-ACR
    Lumican cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57964-CF
    Lumican cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57964-NF
    Lumican cDNA ORF Clone, Mouse, C-His tag MG57964-CH
    Lumican cDNA ORF Clone, Mouse, N-His tag MG57964-NH
    Lumican cDNA ORF Clone, Mouse, C-HA tag MG57964-CY
    Lumican cDNA ORF Clone, Mouse, N-HA tag MG57964-NY
    Lumican cDNA ORF Clone, Mouse, C-Myc tag MG57964-CM
    Lumican cDNA ORF Clone, Mouse, N-Myc tag MG57964-NM

    Lumican cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Lumican cDNA ORF Clone in Cloning Vector, Human HG11640-M
    Lumican cDNA ORF Clone, Human, untagged HG11640-UT
    Lumican Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11640-ACGLN
    Lumican cDNA ORF Clone, Human, C-GFPSpark® tag HG11640-ACG
    Lumican cDNA ORF Clone, Human, C-OFPSpark® tag HG11640-ACR
    Lumican cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11640-NF
    Lumican cDNA ORF Clone, Human, C-His tag HG11640-CH
    Lumican cDNA ORF Clone, Human, N-His tag HG11640-NH
    Lumican cDNA ORF Clone, Human, C-HA tag HG11640-CY
    Lumican cDNA ORF Clone, Human, N-HA tag HG11640-NY
    Lumican cDNA ORF Clone, Human, C-Myc tag HG11640-CM
    Lumican cDNA ORF Clone, Human, N-Myc tag HG11640-NM
    Lumican qPCR Primer Pairs, Human HP101489
    info info
    添加购物车成功! 添加购物车失败!