LDOC1 cDNA ORF Clone, Human, C-His tag

Cat: HG13384-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All LDOC1 Reagents

CRO Services

Product recommended


All LDOC1 Reagents

LDOC1 cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
441 bp
Description
Full length Clone DNA of Human leucine zipper, down-regulated in cancer 1 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LDOC1 cDNA ORF Clone, Human, C-His tag Alternative Names

42070 cDNA ORF Clone, Human;BCUR1 cDNA ORF Clone, Human;Mart7 cDNA ORF Clone, Human

LDOC1 Background Information

Full Name
leucine zipper, down-regulated in cancer 1

LDOC1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
LDOC1 cDNA ORF Clone in Cloning Vector, Rhesus CG90543-G
LDOC1 cDNA ORF Clone, Rhesus, untagged CG90543-UT
LDOC1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90543-ACG
LDOC1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90543-ACGLN
LDOC1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90543-ANG
LDOC1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90543-ACR
LDOC1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90543-ANR
LDOC1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90543-CF
LDOC1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90543-NF
LDOC1 cDNA ORF Clone, Rhesus, C-His tag CG90543-CH
LDOC1 cDNA ORF Clone, Rhesus, N-His tag CG90543-NH
LDOC1 cDNA ORF Clone, Rhesus, C-HA tag CG90543-CY
LDOC1 cDNA ORF Clone, Rhesus, N-HA tag CG90543-NY
LDOC1 cDNA ORF Clone, Rhesus, C-Myc tag CG90543-CM
LDOC1 cDNA ORF Clone, Rhesus, N-Myc tag CG90543-NM

LDOC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LDOC1 cDNA ORF Clone in Cloning Vector, Human HG13384-G
LDOC1 cDNA ORF Clone, Human, untagged HG13384-UT
LDOC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13384-ACGLN
LDOC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13384-ACG
LDOC1 cDNA ORF Clone, Human, N-GFPSpark® tag HG13384-ANG
LDOC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13384-ACR
LDOC1 cDNA ORF Clone, Human, N-OFPSpark® tag HG13384-ANR
LDOC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13384-CF
LDOC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13384-NF
LDOC1 cDNA ORF Clone, Human, N-His tag HG13384-NH
LDOC1 cDNA ORF Clone, Human, C-HA tag HG13384-CY
LDOC1 cDNA ORF Clone, Human, N-HA tag HG13384-NY
LDOC1 cDNA ORF Clone, Human, C-Myc tag HG13384-CM
LDOC1 cDNA ORF Clone, Human, N-Myc tag HG13384-NM
LDOC1 qPCR Primer Pairs, Human HP102088
info info
添加购物车成功! 添加购物车失败!