LAT cDNA ORF Clone, Human, N-HA tag

Cat: HG12094-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All LAT Reagents

CRO Services

Product recommended


All LAT Reagents

LAT cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
789 bp
Description
Full length Clone DNA of Human linker for activation of T cells with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LAT cDNA ORF Clone, Human, N-HA tag Alternative Names

LAT1 cDNA ORF Clone, Human;pp36 cDNA ORF Clone, Human

LAT Background Information

Full Name
linker for activation of T cells

LAT cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LAT cDNA ORF Clone in Cloning Vector, Mouse MG53813-U
LAT cDNA ORF Clone, Mouse, untagged MG53813-UT
LAT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53813-ACGLN
LAT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53813-ACG
LAT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53813-ACR
LAT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53813-CF
LAT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53813-NF
LAT cDNA ORF Clone, Mouse, C-His tag MG53813-CH
LAT cDNA ORF Clone, Mouse, N-His tag MG53813-NH
LAT cDNA ORF Clone, Mouse, C-HA tag MG53813-CY
LAT cDNA ORF Clone, Mouse, N-HA tag MG53813-NY
LAT cDNA ORF Clone, Mouse, C-Myc tag MG53813-CM
LAT cDNA ORF Clone, Mouse, N-Myc tag MG53813-NM

LAT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LAT cDNA ORF Clone in Cloning Vector, Human HG12094-G
LAT cDNA ORF Clone, Human, untagged HG12094-UT
LAT cDNA ORF Clone, Human, untagged HG12407-UT
LAT cDNA ORF Clone, Human, C-GFPSpark® tag HG12094-ACG
LAT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12094-ACGLN
LAT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12407-ACGLN
LAT cDNA ORF Clone, Human, C-OFPSpark® tag HG12094-ACR
LAT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12094-CF
LAT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12094-NF
LAT cDNA ORF Clone, Human, C-His tag HG12094-CH
LAT cDNA ORF Clone, Human, N-His tag HG12094-NH
LAT cDNA ORF Clone, Human, C-HA tag HG12094-CY
LAT cDNA ORF Clone, Human, C-Myc tag HG12094-CM
LAT cDNA ORF Clone, Human, N-Myc tag HG12094-NM
LAT qPCR Primer Pairs, Human HP101622
info info
添加购物车成功! 添加购物车失败!