Ketohexokinase/KHK cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG16336-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Ketohexokinase/KHK Reagents
CRO Services
Product recommended

All Ketohexokinase/KHK Reagents
Ketohexokinase/KHK cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
897 bp
Description
Full length Clone DNA of Human ketohexokinase (fructokinase) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ketohexokinase/KHK Background Information
Full Name
ketohexokinase

Ketohexokinase/KHK cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Ketohexokinase/KHK cDNA ORF Clone in Cloning Vector, Mouse MG52981-G
Ketohexokinase/KHK cDNA ORF Clone, Mouse, untagged MG52981-UT
Ketohexokinase/KHK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52981-ACG
Ketohexokinase/KHK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52981-ACGLN
Ketohexokinase/KHK cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52981-ANG
Ketohexokinase/KHK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52981-ACR
Ketohexokinase/KHK cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52981-ANR
Ketohexokinase/KHK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52981-CF
Ketohexokinase/KHK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52981-NF
Ketohexokinase/KHK cDNA ORF Clone, Mouse, C-His tag MG52981-CH
Ketohexokinase/KHK cDNA ORF Clone, Mouse, N-His tag MG52981-NH
Ketohexokinase/KHK cDNA ORF Clone, Mouse, C-HA tag MG52981-CY
Ketohexokinase/KHK cDNA ORF Clone, Mouse, N-HA tag MG52981-NY
Ketohexokinase/KHK cDNA ORF Clone, Mouse, C-Myc tag MG52981-CM
Ketohexokinase/KHK cDNA ORF Clone, Mouse, N-Myc tag MG52981-NM

Ketohexokinase/KHK cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Ketohexokinase/KHK cDNA ORF Clone in Cloning Vector, Human HG16336-G
Ketohexokinase/KHK cDNA ORF Clone, Human, untagged HG16336-UT
Ketohexokinase/KHK cDNA ORF Clone, Human, C-GFPSpark® tag HG16336-ACG
Ketohexokinase/KHK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16336-ACGLN
Ketohexokinase/KHK cDNA ORF Clone, Human, N-GFPSpark® tag HG16336-ANG
Ketohexokinase/KHK cDNA ORF Clone, Human, C-OFPSpark® tag HG16336-ACR
Ketohexokinase/KHK cDNA ORF Clone, Human, N-OFPSpark® tag HG16336-ANR
Ketohexokinase/KHK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16336-CF
Ketohexokinase/KHK cDNA ORF Clone, Human, C-His tag HG16336-CH
Ketohexokinase/KHK cDNA ORF Clone, Human, N-His tag HG16336-NH
Ketohexokinase/KHK cDNA ORF Clone, Human, C-HA tag HG16336-CY
Ketohexokinase/KHK cDNA ORF Clone, Human, N-HA tag HG16336-NY
Ketohexokinase/KHK cDNA ORF Clone, Human, C-Myc tag HG16336-CM
Ketohexokinase/KHK cDNA ORF Clone, Human, N-Myc tag HG16336-NM
Ketohexokinase/KHK qPCR Primer Pairs, Human HP105089
info info
添加购物车成功! 添加购物车失败!