JAM2 cDNA ORF Clone, Human, C-Myc tag

Cat: HG10580-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All JAM2 Reagents

CRO Services

Product recommended


All JAM2 Reagents

JAM2 cDNA ORF Clone, Human, C-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
897 bp
Description
Full length Clone DNA of Human junctional adhesion molecule 2 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

JAM2 cDNA ORF Clone, Human, C-Myc tag Alternative Names

C21orf43 cDNA ORF Clone, Human;CD322 cDNA ORF Clone, Human;JAM-B cDNA ORF Clone, Human;JAMB cDNA ORF Clone, Human;PRO245 cDNA ORF Clone, Human;VE-JAM cDNA ORF Clone, Human;VEJAM cDNA ORF Clone, Human

JAM2 Background Information

Junctional adhesion molecule B (JAM-B), also known as Junctional adhesion molecule 2 (JAM2), Vascular endothelial junction-associated molecule (VE-JAM), and CD322, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. It is prominently expressed on high endothelial venules. expression to be restricted to the high endothelial venule of tonsil and lymph nodes. The localization to the endothelium of arterioles in and around inflammatory and tumor foci. JAM-B can function as an adhesive ligand for the T cell line J45 and can interact with GM-CSF/IL-4-derived peripheral blood dendritic cells, circulating CD56(+) NK cells, circulating CD56(+)CD3(+) NK/T cells, and circulating CD56(+)CD3(+)CD8(+) cytolytic T cells. JAM-2 is expressed on high endothelial venules (HEVs) in human tonsil and on a subset of human leukocytes, suggesting that JAM-2 plays a central role in the regulation of transendothelial migration. It binds to very late activation antigen (VLA)-4, a leucocyte integrin that contributes to rolling and firm adhesion of lymphocytes to endothelial cells through binding to vascular cell adhesion molecule (VCAM)-1. JAM-B appears to contribute to leucocyte extravasation by facilitating not only transmigration but also rolling and adhesion. JAM-B acts as an adhesive ligand for interacting with a variety of immune cell types and may play a role in lymphocyte homing to secondary lymphoid organs.

Full Name
junctional adhesion molecule 2
References
  • Johnson-Lger CA, et al. (2002) Junctional adhesion molecule-2 (JAM-2) promotes lymphocyte transendothelial migration. Blood. 2100(7): 2479-86.
  • Liang TW, et al. (2002) Vascular endothelial-junctional adhesion molecule (VE-JAM)/JAM 2 interacts with T, NK, and dendritic cells through JAM 3. J Immunol. 168(4): 1618-26.
  • Ludwig RJ, et al. (2009) Junctional adhesion molecule (JAM)-B supports lymphocyte rolling and adhesion through interaction with alpha4beta1 integrin. Immunology. 128(2): 196-205.
  • JAM2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    JAM2 cDNA ORF Clone in Cloning Vector, Rat RG80376-G
    JAM2 cDNA ORF Clone, Rat, untagged RG80376-UT
    JAM2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80376-ACGLN
    JAM2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80376-ACG
    JAM2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80376-ACR
    JAM2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80376-CF
    JAM2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80376-NF
    JAM2 cDNA ORF Clone, Rat, C-His tag RG80376-CH
    JAM2 cDNA ORF Clone, Rat, N-His tag RG80376-NH
    JAM2 cDNA ORF Clone, Rat, C-HA tag RG80376-CY
    JAM2 cDNA ORF Clone, Rat, N-HA tag RG80376-NY
    JAM2 cDNA ORF Clone, Rat, C-Myc tag RG80376-CM
    JAM2 cDNA ORF Clone, Rat, N-Myc tag RG80376-NM
    JAM2 qPCR Primer Pairs, Rat RP300343

    JAM2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    JAM2 cDNA ORF Clone in Cloning Vector, Mouse MG50464-M
    JAM2 cDNA ORF Clone, Mouse, untagged MG50464-UT
    JAM2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50464-ACG
    JAM2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50464-ACGLN
    JAM2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50464-ACR
    JAM2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50464-CF
    JAM2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50464-NF
    JAM2 cDNA ORF Clone, Mouse, C-His tag MG50464-CH
    JAM2 cDNA ORF Clone, Mouse, N-His tag MG50464-NH
    JAM2 cDNA ORF Clone, Mouse, C-HA tag MG50464-CY
    JAM2 cDNA ORF Clone, Mouse, N-HA tag MG50464-NY
    JAM2 cDNA ORF Clone, Mouse, C-Myc tag MG50464-CM
    JAM2 cDNA ORF Clone, Mouse, N-Myc tag MG50464-NM
    JAM2 qPCR Primer Pairs, Mouse MP200092

    JAM2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    JAM2 cDNA ORF Clone in Cloning Vector, Human HG10580-M
    JAM2 cDNA ORF Clone, Human, untagged HG10580-UT
    JAM2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10580-ACGLN
    JAM2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10580-ACG
    JAM2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10580-ACR
    JAM2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10580-CF
    JAM2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10580-NF
    JAM2 cDNA ORF Clone, Human, C-His tag HG10580-CH
    JAM2 cDNA ORF Clone, Human, N-His tag HG10580-NH
    JAM2 cDNA ORF Clone, Human, C-HA tag HG10580-CY
    JAM2 cDNA ORF Clone, Human, N-HA tag HG10580-NY
    JAM2 cDNA ORF Clone, Human, N-Myc tag HG10580-NM
    JAM2 qPCR Primer Pairs, Human HP100585
    info info
    添加购物车成功! 添加购物车失败!