ITM2B cDNA ORF Clone, Human, N-HA tag

Cat: HG14048-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ITM2B Reagents
CRO Services
Product recommended

All ITM2B Reagents
ITM2B cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
801 bp
Description
Full length Clone DNA of Human integral membrane protein 2B with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ITM2B cDNA ORF Clone, Human, N-HA tag Alternative Names
ABRI cDNA ORF Clone, Human;BRI cDNA ORF Clone, Human;BRI2 cDNA ORF Clone, Human;BRICD2B cDNA ORF Clone, Human;E25B cDNA ORF Clone, Human;E3-16 cDNA ORF Clone, Human;FBD cDNA ORF Clone, Human;imBRI2 cDNA ORF Clone, Human;RDGCA cDNA ORF Clone, Human
ITM2B Background Information
Full Name
integral membrane protein 2B

ITM2B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ITM2B cDNA ORF Clone in Cloning Vector, Rat RG81579-G

ITM2B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ITM2B cDNA ORF Clone in Cloning Vector, Mouse MG52184-G
ITM2B cDNA ORF Clone, Mouse, untagged MG52184-UT
ITM2B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52184-ACGLN
ITM2B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52184-ACG
ITM2B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52184-ACR
ITM2B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52184-CF
ITM2B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52184-NF
ITM2B cDNA ORF Clone, Mouse, C-His tag MG52184-CH
ITM2B cDNA ORF Clone, Mouse, N-His tag MG52184-NH
ITM2B cDNA ORF Clone, Mouse, C-HA tag MG52184-CY
ITM2B cDNA ORF Clone, Mouse, N-HA tag MG52184-NY
ITM2B cDNA ORF Clone, Mouse, C-Myc tag MG52184-CM
ITM2B cDNA ORF Clone, Mouse, N-Myc tag MG52184-NM
ITM2B qPCR Primer Pairs, Mouse MP202057

ITM2B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ITM2B cDNA ORF Clone in Cloning Vector, Human HG14048-G
ITM2B cDNA ORF Clone, Human, untagged HG14048-UT
ITM2B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14048-ACGLN
ITM2B cDNA ORF Clone, Human, C-GFPSpark® tag HG14048-ACG
ITM2B cDNA ORF Clone, Human, C-OFPSpark® tag HG14048-ACR
ITM2B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14048-CF
ITM2B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14048-NF
ITM2B cDNA ORF Clone, Human, C-His tag HG14048-CH
ITM2B cDNA ORF Clone, Human, N-His tag HG14048-NH
ITM2B cDNA ORF Clone, Human, C-HA tag HG14048-CY
ITM2B cDNA ORF Clone, Human, C-Myc tag HG14048-CM
ITM2B cDNA ORF Clone, Human, N-Myc tag HG14048-NM
ITM2B qPCR Primer Pairs, Human HP102704
info info
添加购物车成功! 添加购物车失败!