Inhibin beta B cDNA ORF Clone, Human, N-Myc tag

Cat: HG10814-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Inhibin beta B Reagents
CRO Services
Product recommended

All Inhibin beta B Reagents
Inhibin beta B cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1224 bp
Description
Full length Clone DNA of Human inhibin, beta B with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Inhibin beta B cDNA ORF Clone, Human, N-Myc tag Alternative Names
INHBB cDNA ORF Clone, Human;MGC157939 cDNA ORF Clone, Human
Inhibin beta B Background Information

Activin and inhibin are two closely related protein complexes that have almost directly opposite biological effects. The activin and inhibin protein complexes are both dimeric in structure, and, in each complex, the two monomers are linked to one another by a single disulfide bond. Activin is composed of two ß subunits, ßA ßA (activin A), ßB ßB (activin B), or ßA ßB (activin AB). Inhibin is composed of an alpha and one of two ß subunits, ßA (inhibin A) or ßB (inhibin B). Activins are produced in many cell types and organs, such as gonads, pituitary gland, and placenta. In the ovarian follicle, activin increases FSH binding and FSH-induced aromatization. It participates in androgen synthesis enhancing LH action in the ovary and testis. In the male, activin enhances spermatogenesis. In addition, Activin plays a role in wound repair and skin morphogenesis. Activin is strongly expressed in wounded skin, and overexpression of activin in epidermis of transgenic mice improves wound healing and enhances scar formation. Activin also regulates the morphogenesis of branching organs such as the prostate, lung, and kidney. There is also evidence showed that lack of activin during development results in neural developmental defects.

Full Name
inhibin beta B
References
  • Feng ZM, et al. (1989) Characterization and regulation of testicular inhibin beta-subunit mRNA. Mol Endocrinol. 3 (6): 939-48.
  • Bernard DJ, et al. (2002) Inhibin binding protein (InhBP/p120), betaglycan, and the continuing search for the inhibin receptor. Mol Endocrinol. 16 (2): 207-12.
  • Lejeune H, et al. (1997) Stimulating effect of both human recombinant inhibin A and activin A on immature porcine Leydig cell functions in vitro. Endocrinology. 138 (11): 4783-91.
  • info info
    添加购物车成功! 添加购物车失败!