IL7R alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10975-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All IL7R alpha Reagents

CRO Services

Product recommended


All IL7R alpha Reagents

IL7R alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1380 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 7 receptor with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 1.42kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL7R alpha cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL7R alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5609

IL7R alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

CD127 cDNA ORF Clone, Human;CDW127 cDNA ORF Clone, Human;IL-7R cDNA ORF Clone, Human;IL-7R-alpha cDNA ORF Clone, Human;IL7RA cDNA ORF Clone, Human;ILRA cDNA ORF Clone, Human

IL7R alpha Background Information

Interleukin 7 Receptor alpha (IL-7RA), also known as CD127, is a 75 kDa hematopoietin receptor superfamily member that plays an important role in lymphocyte differentiation, proliferation, and survival. IL-7 receptor alpha (CD127) signaling is essential for T-cell development and regulation of naive and memory T-cell homeostasis. IL-7RA is critically required for the proper development and function of lymphoid cells. Therefore, the IL-7RA is critically required for the proper development and function of lymphoid cells. Studies from both pathogenic and controlled HIV infection indicate that the containment of immune activation and preservation of CD127 expression are critical to the stability of CD4(+) T cells in infection. A better understanding of the factors regulating CD127 expression in HIV disease, particularly on T(CM) cells, might unveil new approaches exploiting the IL-7/IL-7R receptor pathway to restore T cell homeostasis and promote immune reconstitution in HIV infection. Factors relevant to HIV infection that could potentially decrease CD127 expression on human CD8(+) T cells. CD127 down-regulation may be an important contributor to HIV-associated T-cell dysfunction. In addition to IL-7, IL-7RA also associates with TSLPR to form the functional receptor for thymic stromal lymphopoietin (TSLP) which indirectly regulates T cell development by modulating dendritic cell activation. Mutations in the human IL-7RA gene cause a type of severe combined immunodeficiency in which the major deficiencies are in T cell development, whereas B and NK cells are relatively normal in number. Variation in the IL7RA gene was recently found associated with multiple sclerosis (MS). The polymorphisms in the IL7RA gene is involved in MS pathogenesis and suggest that IL7RA variation may primarily affect chronic disease courses. Soluble CD127 (sCD127) appears to play an important role in the immunopathogenesis of several chronic infections, multiple sclerosis, and various cancers.

Full Name
interleukin 7 receptor
References
  • Vranjkovic A, et al. (2007) IL-7 decreases IL-7 receptor alpha (CD127) expression and induces the shedding of CD127 by human CD8+ T cells. Int Immunol. 19(12): 1329-39.
  • Kiazyk SA, et al. (2008) Loss of CD127 expression links immune activation and CD4(+) T cell loss in HIV infection. Trends Microbiol. 16(12): 567-73.
  • Akkad DA, et al. (2009) Variation in the IL7RA and IL2RA genes in German multiple sclerosis patients. J Autoimmun. 32(2): 110-5.
  • Crawley AM, et al. (2010) Soluble IL-7R alpha (sCD127) inhibits IL-7 activity and is increased in HIV infection. J Immunol. 184(9): 4679-87.
  • IL7R alpha cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL7R alpha cDNA ORF Clone in Cloning Vector, Rat RG80083-M
    IL7R alpha cDNA ORF Clone, Rat, untagged RG80083-UT
    IL7R alpha cDNA ORF Clone, Rat, C-GFPSpark® tag RG80083-ACG
    IL7R alpha Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80083-ACGLN
    IL7R alpha cDNA ORF Clone, Rat, C-OFPSpark® tag RG80083-ACR
    IL7R alpha cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80083-CF
    IL7R alpha cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80083-NF
    IL7R alpha cDNA ORF Clone, Rat, C-His tag RG80083-CH
    IL7R alpha cDNA ORF Clone, Rat, N-His tag RG80083-NH
    IL7R alpha cDNA ORF Clone, Rat, C-HA tag RG80083-CY
    IL7R alpha cDNA ORF Clone, Rat, N-HA tag RG80083-NY
    IL7R alpha cDNA ORF Clone, Rat, C-Myc tag RG80083-CM
    IL7R alpha cDNA ORF Clone, Rat, N-Myc tag RG80083-NM
    IL7R alpha qPCR Primer Pairs, Rat RP300079

    IL7R alpha cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL7R alpha cDNA ORF Clone in Cloning Vector, Mouse MG50090-M
    IL7R alpha cDNA ORF Clone, Mouse, untagged MG50090-UT
    IL7R alpha Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50090-ACGLN
    IL7R alpha cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50090-ACG
    IL7R alpha cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50090-ACR
    IL7R alpha cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50090-CF
    IL7R alpha cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50090-NF
    IL7R alpha cDNA ORF Clone, Mouse, C-His tag MG50090-CH
    IL7R alpha cDNA ORF Clone, Mouse, N-His tag MG50090-NH
    IL7R alpha cDNA ORF Clone, Mouse, C-HA tag MG50090-CY
    IL7R alpha cDNA ORF Clone, Mouse, N-HA tag MG50090-NY
    IL7R alpha cDNA ORF Clone, Mouse, C-Myc tag MG50090-CM
    IL7R alpha cDNA ORF Clone, Mouse, N-Myc tag MG50090-NM
    IL7R alpha qPCR Primer Pairs, Mouse MP200120

    IL7R alpha cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL7R alpha cDNA ORF Clone in Cloning Vector, Human HG10975-G
    IL7R alpha cDNA ORF Clone, Human, untagged HG11851-UT
    IL7R alpha cDNA ORF Clone, Human, untagged HG10975-UT
    IL7R alpha Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11851-ACGLN
    IL7R alpha Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10975-ACGLN
    IL7R alpha cDNA ORF Clone, Human, C-GFPSpark® tag HG10975-ACG
    IL7R alpha cDNA ORF Clone, Human, C-OFPSpark® tag HG10975-ACR
    IL7R alpha cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10975-NF
    IL7R alpha cDNA ORF Clone, Human, C-His tag HG10975-CH
    IL7R alpha cDNA ORF Clone, Human, N-His tag HG10975-NH
    IL7R alpha cDNA ORF Clone, Human, C-HA tag HG10975-CY
    IL7R alpha cDNA ORF Clone, Human, N-HA tag HG10975-NY
    IL7R alpha cDNA ORF Clone, Human, C-Myc tag HG10975-CM
    IL7R alpha cDNA ORF Clone, Human, N-Myc tag HG10975-NM
    IL7R alpha qPCR Primer Pairs, Human HP100936
    info info
    添加购物车成功! 添加购物车失败!