IGSF5 cDNA ORF Clone, Human, N-Myc tag

Cat: HG16099-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IGSF5 Reagents
CRO Services
Product recommended

All IGSF5 Reagents
IGSF5 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1224 bp
Description
Full length Clone DNA of Human immunoglobulin superfamily, member 5 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IGSF5 cDNA ORF Clone, Human, N-Myc tag Alternative Names
GSF5 cDNA ORF Clone, Human;JAM4 cDNA ORF Clone, Human
IGSF5 Background Information
Full Name
immunoglobulin superfamily, member 5

IGSF5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IGSF5 cDNA ORF Clone in Cloning Vector, Mouse MG5A3035-U
IGSF5 cDNA ORF Clone, Mouse, untagged MG5A3035-UT
IGSF5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3035-ACGLN
IGSF5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3035-ACG
IGSF5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3035-ACR
IGSF5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3035-CF
IGSF5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3035-NF
IGSF5 cDNA ORF Clone, Mouse, C-His tag MG5A3035-CH
IGSF5 cDNA ORF Clone, Mouse, N-His tag MG5A3035-NH
IGSF5 cDNA ORF Clone, Mouse, C-HA tag MG5A3035-CY
IGSF5 cDNA ORF Clone, Mouse, N-HA tag MG5A3035-NY
IGSF5 cDNA ORF Clone, Mouse, C-Myc tag MG5A3035-CM
IGSF5 cDNA ORF Clone, Mouse, N-Myc tag MG5A3035-NM

IGSF5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IGSF5 cDNA ORF Clone in Cloning Vector, Human HG16099-G
IGSF5 cDNA ORF Clone, Human, untagged HG16099-UT
IGSF5 cDNA ORF Clone, Human, C-GFPSpark® tag HG16099-ACG
IGSF5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16099-ACGLN
IGSF5 cDNA ORF Clone, Human, C-OFPSpark® tag HG16099-ACR
IGSF5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16099-CF
IGSF5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16099-NF
IGSF5 cDNA ORF Clone, Human, C-His tag HG16099-CH
IGSF5 cDNA ORF Clone, Human, N-His tag HG16099-NH
IGSF5 cDNA ORF Clone, Human, C-HA tag HG16099-CY
IGSF5 cDNA ORF Clone, Human, N-HA tag HG16099-NY
IGSF5 cDNA ORF Clone, Human, C-Myc tag HG16099-CM
info info
添加购物车成功! 添加购物车失败!