IFI30 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG16347-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IFI30 Reagents
CRO Services
Product recommended

All IFI30 Reagents
IFI30 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
753 bp
Description
Full length Clone DNA of Human interferon, gamma-inducible protein 30 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IFI30 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
GILT cDNA ORF Clone, Human;IFI-30 cDNA ORF Clone, Human;IFI30 cDNA ORF Clone, Human;IP-30 cDNA ORF Clone, Human;IP30 cDNA ORF Clone, Human
IFI30 Background Information

IFI30 belongs to the GILT family. This family includes the two characterised human gamma-interferon-inducible lysosomal thiol reductase (GILT) sequences: P13284 and Q9UL08. It also contains several other eukaryotic putative proteins with similarity to GILT. The aligned region contains three conserved cysteine residues. In addition, the two GILT sequences possess a C-X(2)-C motif that is shared by some of the other sequences in the family. This motif is thought to be associated with disulphide bond reduction. IFI30 is a lysosomal thiol reductase that can reduce protein disulfide bonds. It facilitates the generation of MHC class II-restricted epitodes from disulfide bond-containing antigen by the endocytic reduction of disulfide bonds. It also facilitates MHC class I-restricted recognition of exogenous antigens containing disulfide bonds by CD8+ T-cells or crosspresentation. IFI30 may facilitate the complete unfolding of proteins destined for lysosomal degradation and plays an important role in antigen processing.

Full Name
interferon gamma inducible protein 30
References
  • Haque MA, et al. (2002) Absence of gamma-Interferon-inducible Lysosomal Thiol Reductase in Melanomas Disrupts T Cell Recognition of Select Immunodominant Epitopes. J Exp Med. 195(10):1267-77.
  • Phan UT, et al. (2000) Gamma-interferon-inducible lysosomal thiol reductase (GILT). Maturation, activity, and mechanism of action. J Biol Chem. 275(34):25907-14.
  • Phan UT, et al. (2001) Multiple species express thiol oxidoreductases related to GILT. Immunogenetics. 53(4):342-6.
  • IFI30 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IFI30 cDNA ORF Clone in Cloning Vector, Mouse MG53522-G
    IFI30 cDNA ORF Clone, Mouse, untagged MG53522-UT
    IFI30 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53522-ACG
    IFI30 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53522-ACGLN
    IFI30 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53522-ACR
    IFI30 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53522-CF
    IFI30 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53522-NF
    IFI30 cDNA ORF Clone, Mouse, C-His tag MG53522-CH
    IFI30 cDNA ORF Clone, Mouse, N-His tag MG53522-NH
    IFI30 cDNA ORF Clone, Mouse, C-HA tag MG53522-CY
    IFI30 cDNA ORF Clone, Mouse, N-HA tag MG53522-NY
    IFI30 cDNA ORF Clone, Mouse, C-Myc tag MG53522-CM
    IFI30 cDNA ORF Clone, Mouse, N-Myc tag MG53522-NM

    IFI30 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IFI30 cDNA ORF Clone in Cloning Vector, Human HG16347-G
    IFI30 cDNA ORF Clone, Human, untagged HG16347-UT
    IFI30 cDNA ORF Clone, Human, C-GFPSpark® tag HG16347-ACG
    IFI30 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16347-ACGLN
    IFI30 cDNA ORF Clone, Human, C-OFPSpark® tag HG16347-ACR
    IFI30 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16347-CF
    IFI30 cDNA ORF Clone, Human, C-His tag HG16347-CH
    IFI30 cDNA ORF Clone, Human, N-His tag HG16347-NH
    IFI30 cDNA ORF Clone, Human, C-HA tag HG16347-CY
    IFI30 cDNA ORF Clone, Human, N-HA tag HG16347-NY
    IFI30 cDNA ORF Clone, Human, C-Myc tag HG16347-CM
    IFI30 cDNA ORF Clone, Human, N-Myc tag HG16347-NM
    IFI30 qPCR Primer Pairs, Human HP105100
    info info
    添加购物车成功! 添加购物车失败!