HSP90 cDNA ORF Clone, Human, N-His tag

Cat: HG11381-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HSP90 Reagents
CRO Services
Product recommended

All HSP90 Reagents
HSP90 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2175 bp
Description
Full length Clone DNA of Human heat shock protein 90kDa alpha (cytosolic), class B member 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HSP90 cDNA ORF Clone, Human, N-His tag Alternative Names
D6S182 cDNA ORF Clone, Human;HSP84 cDNA ORF Clone, Human;HSP90B cDNA ORF Clone, Human;HSPC2 cDNA ORF Clone, Human;HSPCB cDNA ORF Clone, Human
HSP90 Background Information
Full Name
heat shock protein 90kDa alpha (cytosolic), class B member 1

HSP90 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HSP90 cDNA ORF Clone in Cloning Vector, Rat RG81038-U
HSP90 cDNA ORF Clone, Rat, untagged RG81038-UT
HSP90 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81038-ACG
HSP90 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81038-ACGLN
HSP90 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81038-ANG
HSP90 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81038-ACR
HSP90 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81038-ANR
HSP90 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81038-CF
HSP90 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81038-NF
HSP90 cDNA ORF Clone, Rat, C-His tag RG81038-CH
HSP90 cDNA ORF Clone, Rat, N-His tag RG81038-NH
HSP90 cDNA ORF Clone, Rat, C-HA tag RG81038-CY
HSP90 cDNA ORF Clone, Rat, N-HA tag RG81038-NY
HSP90 cDNA ORF Clone, Rat, C-Myc tag RG81038-CM
HSP90 cDNA ORF Clone, Rat, N-Myc tag RG81038-NM
HSP90 qPCR Primer Pairs, Rat RP301002

HSP90 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HSP90 cDNA ORF Clone, Mouse, untagged MG57572-UT

HSP90 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HSP90 cDNA ORF Clone in Cloning Vector, Human HG11381-G
HSP90 cDNA ORF Clone, Human, untagged HG11381-UT
HSP90 cDNA ORF Clone, Human, C-GFPSpark® tag HG11381-ACG
HSP90 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11381-ACGLN
HSP90 cDNA ORF Clone, Human, N-GFPSpark® tag HG11381-ANG
HSP90 cDNA ORF Clone, Human, C-OFPSpark® tag HG11381-ACR
HSP90 cDNA ORF Clone, Human, N-OFPSpark® tag HG11381-ANR
HSP90 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11381-CF
HSP90 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11381-NF
HSP90 cDNA ORF Clone, Human, C-His tag HG11381-CH
HSP90 cDNA ORF Clone, Human, C-HA tag HG11381-CY
HSP90 cDNA ORF Clone, Human, N-HA tag HG11381-NY
HSP90 cDNA ORF Clone, Human, C-Myc tag HG11381-CM
HSP90 cDNA ORF Clone, Human, N-Myc tag HG11381-NM
HSP90 qPCR Primer Pairs, Human HP100006
info info
添加购物车成功! 添加购物车失败!