HSD17B2 cDNA ORF Clone, Human, C-Myc tag

Cat: HG13541-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All HSD17B2 Reagents

CRO Services

Product recommended


All HSD17B2 Reagents

HSD17B2 cDNA ORF Clone, Human, C-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1164 bp
Description
Full length Clone DNA of Human hydroxysteroid (17-beta) dehydrogenase 2 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HSD17B2 cDNA ORF Clone, Human, C-Myc tag Alternative Names

EDH17B2 cDNA ORF Clone, Human;HSD17 cDNA ORF Clone, Human;SDR9C2 cDNA ORF Clone, Human

HSD17B2 Background Information

Full Name
hydroxysteroid (17-beta) dehydrogenase 2

HSD17B2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HSD17B2 cDNA ORF Clone in Cloning Vector, Rat RG81023-U
HSD17B2 cDNA ORF Clone, Rat, untagged RG81023-UT
HSD17B2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81023-ACGLN
HSD17B2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81023-ACG
HSD17B2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81023-ANG
HSD17B2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81023-ACR
HSD17B2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81023-ANR
HSD17B2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81023-CF
HSD17B2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81023-NF
HSD17B2 cDNA ORF Clone, Rat, C-His tag RG81023-CH
HSD17B2 cDNA ORF Clone, Rat, N-His tag RG81023-NH
HSD17B2 cDNA ORF Clone, Rat, C-HA tag RG81023-CY
HSD17B2 cDNA ORF Clone, Rat, N-HA tag RG81023-NY
HSD17B2 cDNA ORF Clone, Rat, C-Myc tag RG81023-CM
HSD17B2 cDNA ORF Clone, Rat, N-Myc tag RG81023-NM
HSD17B2 qPCR Primer Pairs, Rat RP300987

HSD17B2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HSD17B2 cDNA ORF Clone in Cloning Vector, Mouse MG5A1039-U
HSD17B2 cDNA ORF Clone, Mouse, untagged MG5A1039-UT
HSD17B2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1039-ACG
HSD17B2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1039-ACGLN
HSD17B2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1039-ANG
HSD17B2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1039-ACR
HSD17B2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1039-ANR
HSD17B2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1039-CF
HSD17B2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1039-NF
HSD17B2 cDNA ORF Clone, Mouse, C-His tag MG5A1039-CH
HSD17B2 cDNA ORF Clone, Mouse, N-His tag MG5A1039-NH
HSD17B2 cDNA ORF Clone, Mouse, C-HA tag MG5A1039-CY
HSD17B2 cDNA ORF Clone, Mouse, N-HA tag MG5A1039-NY
HSD17B2 cDNA ORF Clone, Mouse, C-Myc tag MG5A1039-CM
HSD17B2 cDNA ORF Clone, Mouse, N-Myc tag MG5A1039-NM

HSD17B2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HSD17B2 cDNA ORF Clone in Cloning Vector, Human HG13541-G
HSD17B2 cDNA ORF Clone, Human, untagged HG13541-UT
HSD17B2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13541-ACG
HSD17B2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13541-ACGLN
HSD17B2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13541-ACR
HSD17B2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13541-CF
HSD17B2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13541-NF
HSD17B2 cDNA ORF Clone, Human, C-His tag HG13541-CH
HSD17B2 cDNA ORF Clone, Human, N-His tag HG13541-NH
HSD17B2 cDNA ORF Clone, Human, C-HA tag HG13541-CY
HSD17B2 cDNA ORF Clone, Human, N-HA tag HG13541-NY
HSD17B2 cDNA ORF Clone, Human, N-Myc tag HG13541-NM
HSD17B2 qPCR Primer Pairs, Human HP102227
info info
添加购物车成功! 添加购物车失败!