HNRNPM cDNA ORF Clone, Human, untagged

Cat: HG14228-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All HNRNPM Reagents

CRO Services

Product recommended


All HNRNPM Reagents

HNRNPM cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2193 bp
Description
Full length Clone DNA of Human heterogeneous nuclear ribonucleoprotein M.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HNRNPM cDNA ORF Clone, Human, untagged Alternative Names

CEAR cDNA ORF Clone, Human;hnRNP M cDNA ORF Clone, Human;HNRNPM4 cDNA ORF Clone, Human;HNRPM cDNA ORF Clone, Human;HNRPM4 cDNA ORF Clone, Human;HTGR1 cDNA ORF Clone, Human;NAGR1 cDNA ORF Clone, Human

HNRNPM Background Information

Full Name
heterogeneous nuclear ribonucleoprotein M

HNRNPM cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HNRNPM cDNA ORF Clone in Cloning Vector, Mouse MG53799-U
HNRNPM cDNA ORF Clone, Mouse, untagged MG53799-UT
HNRNPM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53799-ACGLN
HNRNPM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53799-ACG
HNRNPM cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53799-ANG
HNRNPM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53799-ACR
HNRNPM cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53799-ANR
HNRNPM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53799-CF
HNRNPM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53799-NF
HNRNPM cDNA ORF Clone, Mouse, C-His tag MG53799-CH
HNRNPM cDNA ORF Clone, Mouse, N-His tag MG53799-NH
HNRNPM cDNA ORF Clone, Mouse, C-HA tag MG53799-CY
HNRNPM cDNA ORF Clone, Mouse, N-HA tag MG53799-NY
HNRNPM cDNA ORF Clone, Mouse, C-Myc tag MG53799-CM
HNRNPM cDNA ORF Clone, Mouse, N-Myc tag MG53799-NM

HNRNPM cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HNRNPM cDNA ORF Clone in Cloning Vector, Human HG14228-G
HNRNPM cDNA ORF Clone, Human, C-GFPSpark® tag HG14228-ACG
HNRNPM Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14228-ACGLN
HNRNPM cDNA ORF Clone, Human, N-GFPSpark® tag HG14228-ANG
HNRNPM cDNA ORF Clone, Human, C-OFPSpark® tag HG14228-ACR
HNRNPM cDNA ORF Clone, Human, N-OFPSpark® tag HG14228-ANR
HNRNPM cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14228-CF
HNRNPM cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14228-NF
HNRNPM cDNA ORF Clone, Human, C-His tag HG14228-CH
HNRNPM cDNA ORF Clone, Human, N-His tag HG14228-NH
HNRNPM cDNA ORF Clone, Human, C-HA tag HG14228-CY
HNRNPM cDNA ORF Clone, Human, N-HA tag HG14228-NY
HNRNPM cDNA ORF Clone, Human, C-Myc tag HG14228-CM
HNRNPM cDNA ORF Clone, Human, N-Myc tag HG14228-NM
HNRNPM qPCR Primer Pairs, Human HP102878
info info
添加购物车成功! 添加购物车失败!