HHLA2 cDNA ORF Clone, Human, untagged

Cat: HG16139-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HHLA2 Reagents
CRO Services
Product recommended

All HHLA2 Reagents
HHLA2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1245 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human HERV-H LTR-associating 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI(6.1kb+1.25kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
HHLA2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HHLA2 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
HHLA2 cDNA ORF Clone, Human, untagged Alternative Names
B7-H7 cDNA ORF Clone, Human;B7H7 cDNA ORF Clone, Human;HHLA2 cDNA ORF Clone, Human
HHLA2 Background Information

B7H7 gene encodes a protein ligand found on the surface of monocytes. The encoded protein is thought to regulate cell-mediated immunity by binding to a receptor on T lymphocytes and inhibiting the proliferation of these cells. Alternate splicing results in multiple transcript variants.
HERV–H LTR-associating 2 (HHLA2, also called B7H7/B7-H5/B7y)has been recently discovered as the newest member of the B7 family and has 23–33% similarity in amino acid sequence with the other B7 molecules. This ligand is the only B7 family member that is found in humans but not in mice. It is constitutively expressed on the surface of human monocytes and is induced on B cells. HHLA2 binds to its putative receptor(s) on a variety of immune cells including CD4 and CD8 T cells and antigen-presenting cells. Similarly to B7-H3, both a T cell coinhibitory role as well as a costimulatory role has been reported for this ligand.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
HERV-H LTR-associating 2
References
  • Janakiram M, Chinai JM, Fineberg S, et al. Expression, clinical significance, and receptor identification of the newest B7 family member HHLA2 protein. Clinical cancer research : an official journal of the American Association for Cancer Research. 2015;21(10):2359-2366.
  • info info
    添加购物车成功! 添加购物车失败!