HEXIM1 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14736-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All HEXIM1 Reagents

CRO Services

Product recommended


All HEXIM1 Reagents

HEXIM1 cDNA ORF Clone, Human, C-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1080 bp
Description
Full length Clone DNA of Human hexamethylene bis-acetamide inducible 1 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HEXIM1 cDNA ORF Clone, Human, C-Myc tag Alternative Names

CLP1 cDNA ORF Clone, Human;EDG1 cDNA ORF Clone, Human;HIS1 cDNA ORF Clone, Human;MAQ1 cDNA ORF Clone, Human

HEXIM1 Background Information

Full Name
hexamethylene bis-acetamide inducible 1

HEXIM1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HEXIM1 cDNA ORF Clone in Cloning Vector, Rat RG8A0658-U
HEXIM1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0658-ACGLN

HEXIM1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HEXIM1 cDNA ORF Clone in Cloning Vector, Mouse MG52611-G
HEXIM1 cDNA ORF Clone, Mouse, untagged MG52611-UT
HEXIM1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52611-ACG
HEXIM1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52611-ACGLN
HEXIM1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52611-ANG
HEXIM1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52611-ACR
HEXIM1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52611-ANR
HEXIM1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52611-CF
HEXIM1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52611-NF
HEXIM1 cDNA ORF Clone, Mouse, C-His tag MG52611-CH
HEXIM1 cDNA ORF Clone, Mouse, N-His tag MG52611-NH
HEXIM1 cDNA ORF Clone, Mouse, C-HA tag MG52611-CY
HEXIM1 cDNA ORF Clone, Mouse, N-HA tag MG52611-NY
HEXIM1 cDNA ORF Clone, Mouse, C-Myc tag MG52611-CM
HEXIM1 cDNA ORF Clone, Mouse, N-Myc tag MG52611-NM
HEXIM1 qPCR Primer Pairs, Mouse MP202482

HEXIM1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HEXIM1 cDNA ORF Clone in Cloning Vector, Human HG14736-U
HEXIM1 cDNA ORF Clone, Human, untagged HG14736-UT
HEXIM1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14736-ACG
HEXIM1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14736-ACGLN
HEXIM1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14736-ANG
HEXIM1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14736-ACR
HEXIM1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14736-ANR
HEXIM1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14736-CF
HEXIM1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14736-NF
HEXIM1 cDNA ORF Clone, Human, C-His tag HG14736-CH
HEXIM1 cDNA ORF Clone, Human, N-His tag HG14736-NH
HEXIM1 cDNA ORF Clone, Human, C-HA tag HG14736-CY
HEXIM1 cDNA ORF Clone, Human, N-HA tag HG14736-NY
HEXIM1 cDNA ORF Clone, Human, N-Myc tag HG14736-NM
HEXIM1 qPCR Primer Pairs, Human HP103369
info info
添加购物车成功! 添加购物车失败!