HBB/hemoglobin-beta cDNA ORF Clone, Human, untagged

Cat: HG12016-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All HBB/hemoglobin-beta Reagents

CRO Services

Product recommended


All HBB/hemoglobin-beta Reagents

HBB/hemoglobin-beta cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
444 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human hemoglobin, beta.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 0.44kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HBB/hemoglobin-beta cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HBB/hemoglobin-beta cDNA ORF Clone, Human, untagged Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5613

HBB/hemoglobin-beta cDNA ORF Clone, Human, untagged Alternative Names

beta-globin cDNA ORF Clone, Human;CD113t-C cDNA ORF Clone, Human

HBB/hemoglobin-beta Background Information

Full Name
hemoglobin, beta

HBB/hemoglobin-beta cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HBB/hemoglobin-beta cDNA ORF Clone in Cloning Vector, Rat RG80499-U
HBB/hemoglobin-beta cDNA ORF Clone, Rat, untagged RG80499-UT
HBB/hemoglobin-beta Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80499-ACGLN
HBB/hemoglobin-beta cDNA ORF Clone, Rat, C-GFPSpark® tag RG80499-ACG
HBB/hemoglobin-beta cDNA ORF Clone, Rat, N-GFPSpark® tag RG80499-ANG
HBB/hemoglobin-beta cDNA ORF Clone, Rat, C-OFPSpark® tag RG80499-ACR
HBB/hemoglobin-beta cDNA ORF Clone, Rat, N-OFPSpark® tag RG80499-ANR
HBB/hemoglobin-beta cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80499-CF
HBB/hemoglobin-beta cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80499-NF
HBB/hemoglobin-beta cDNA ORF Clone, Rat, C-His tag RG80499-CH
HBB/hemoglobin-beta cDNA ORF Clone, Rat, N-His tag RG80499-NH
HBB/hemoglobin-beta cDNA ORF Clone, Rat, C-HA tag RG80499-CY
HBB/hemoglobin-beta cDNA ORF Clone, Rat, N-HA tag RG80499-NY
HBB/hemoglobin-beta cDNA ORF Clone, Rat, C-Myc tag RG80499-CM
HBB/hemoglobin-beta cDNA ORF Clone, Rat, N-Myc tag RG80499-NM
HBB/hemoglobin-beta qPCR Primer Pairs, Rat RP300463

HBB/hemoglobin-beta cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HBB/hemoglobin-beta cDNA ORF Clone in Cloning Vector, Mouse MG51438-G
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, untagged MG51438-UT
HBB/hemoglobin-beta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51438-ACGLN
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51438-ACG
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51438-ANG
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51438-ACR
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51438-ANR
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51438-CF
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51438-NF
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, C-His tag MG51438-CH
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, N-His tag MG51438-NH
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, C-HA tag MG51438-CY
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, N-HA tag MG51438-NY
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, C-Myc tag MG51438-CM
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, N-Myc tag MG51438-NM
HBB/hemoglobin-beta qPCR Primer Pairs, Mouse MP201322

HBB/hemoglobin-beta cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HBB/hemoglobin-beta cDNA ORF Clone in Cloning Vector, Human HG12016-G
HBB/hemoglobin-beta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12016-ACGLN
HBB/hemoglobin-beta cDNA ORF Clone, Human, C-GFPSpark® tag HG12016-ACG
HBB/hemoglobin-beta cDNA ORF Clone, Human, N-GFPSpark® tag HG12016-ANG
HBB/hemoglobin-beta cDNA ORF Clone, Human, C-OFPSpark® tag HG12016-ACR
HBB/hemoglobin-beta cDNA ORF Clone, Human, N-OFPSpark® tag HG12016-ANR
HBB/hemoglobin-beta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12016-CF
HBB/hemoglobin-beta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12016-NF
HBB/hemoglobin-beta cDNA ORF Clone, Human, C-His tag HG12016-CH
HBB/hemoglobin-beta cDNA ORF Clone, Human, N-His tag HG12016-NH
HBB/hemoglobin-beta cDNA ORF Clone, Human, C-HA tag HG12016-CY
HBB/hemoglobin-beta cDNA ORF Clone, Human, N-HA tag HG12016-NY
HBB/hemoglobin-beta cDNA ORF Clone, Human, C-Myc tag HG12016-CM
HBB/hemoglobin-beta cDNA ORF Clone, Human, N-Myc tag HG12016-NM
HBB/hemoglobin-beta qPCR Primer Pairs, Human HP101552
info info
添加购物车成功! 添加购物车失败!