HAAO cDNA ORF Clone, Human, N-HA tag

Cat: HG14621-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HAAO Reagents
CRO Services
Product recommended

All HAAO Reagents
HAAO cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
861 bp
Description
Full length Clone DNA of Human 3-hydroxyanthranilate 3,4-dioxygenase with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HAAO cDNA ORF Clone, Human, N-HA tag Alternative Names
3-HAO cDNA ORF Clone, Human;HAO cDNA ORF Clone, Human
HAAO Background Information
Full Name
3-hydroxyanthranilate 3,4-dioxygenase

HAAO cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HAAO cDNA ORF Clone in Cloning Vector, Rat RG80627-U
HAAO cDNA ORF Clone, Rat, untagged RG80627-UT
HAAO cDNA ORF Clone, Rat, C-GFPSpark® tag RG80627-ACG
HAAO Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80627-ACGLN
HAAO cDNA ORF Clone, Rat, N-GFPSpark® tag RG80627-ANG
HAAO cDNA ORF Clone, Rat, C-OFPSpark® tag RG80627-ACR
HAAO cDNA ORF Clone, Rat, N-OFPSpark® tag RG80627-ANR
HAAO cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80627-CF
HAAO cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80627-NF
HAAO cDNA ORF Clone, Rat, C-His tag RG80627-CH
HAAO cDNA ORF Clone, Rat, N-His tag RG80627-NH
HAAO cDNA ORF Clone, Rat, C-HA tag RG80627-CY
HAAO cDNA ORF Clone, Rat, N-HA tag RG80627-NY
HAAO cDNA ORF Clone, Rat, C-Myc tag RG80627-CM
HAAO cDNA ORF Clone, Rat, N-Myc tag RG80627-NM
HAAO qPCR Primer Pairs, Rat RP300591

HAAO cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HAAO cDNA ORF Clone in Cloning Vector, Mouse MG53376-U
HAAO cDNA ORF Clone, Mouse, untagged MG53376-UT
HAAO cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53376-ACG
HAAO Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53376-ACGLN
HAAO cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53376-ANG
HAAO cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53376-ACR
HAAO cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53376-ANR
HAAO cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53376-CF
HAAO cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53376-NF
HAAO cDNA ORF Clone, Mouse, C-His tag MG53376-CH
HAAO cDNA ORF Clone, Mouse, N-His tag MG53376-NH
HAAO cDNA ORF Clone, Mouse, C-HA tag MG53376-CY
HAAO cDNA ORF Clone, Mouse, N-HA tag MG53376-NY
HAAO cDNA ORF Clone, Mouse, C-Myc tag MG53376-CM
HAAO cDNA ORF Clone, Mouse, N-Myc tag MG53376-NM

HAAO cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HAAO cDNA ORF Clone in Cloning Vector, Human HG14621-G
HAAO cDNA ORF Clone, Human, untagged HG14621-UT
HAAO Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14621-ACGLN
HAAO cDNA ORF Clone, Human, C-GFPSpark® tag HG14621-ACG
HAAO cDNA ORF Clone, Human, N-GFPSpark® tag HG14621-ANG
HAAO cDNA ORF Clone, Human, C-OFPSpark® tag HG14621-ACR
HAAO cDNA ORF Clone, Human, N-OFPSpark® tag HG14621-ANR
HAAO cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14621-CF
HAAO cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14621-NF
HAAO cDNA ORF Clone, Human, C-His tag HG14621-CH
HAAO cDNA ORF Clone, Human, N-His tag HG14621-NH
HAAO cDNA ORF Clone, Human, C-HA tag HG14621-CY
HAAO cDNA ORF Clone, Human, C-Myc tag HG14621-CM
HAAO cDNA ORF Clone, Human, N-Myc tag HG14621-NM
HAAO qPCR Primer Pairs, Human HP103255
info info
添加购物车成功! 添加购物车失败!