GTF2B cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG16286-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All GTF2B Reagents

CRO Services

Product recommended


All GTF2B Reagents

GTF2B cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
951 bp
Description
Full length Clone DNA of Human general transcription factor IIB with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GTF2B cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

TF2B cDNA ORF Clone, Human;TFIIB cDNA ORF Clone, Human

GTF2B Background Information

Full Name
general transcription factor IIB

GTF2B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GTF2B cDNA ORF Clone in Cloning Vector, Rat RG83516-U
GTF2B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83516-ACGLN

GTF2B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GTF2B cDNA ORF Clone in Cloning Vector, Mouse MG52880-G
GTF2B cDNA ORF Clone, Mouse, untagged MG52880-UT
GTF2B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52880-ACGLN
GTF2B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52880-ACG
GTF2B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52880-ANG
GTF2B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52880-ACR
GTF2B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52880-ANR
GTF2B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52880-CF
GTF2B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52880-NF
GTF2B cDNA ORF Clone, Mouse, C-His tag MG52880-CH
GTF2B cDNA ORF Clone, Mouse, N-His tag MG52880-NH
GTF2B cDNA ORF Clone, Mouse, C-HA tag MG52880-CY
GTF2B cDNA ORF Clone, Mouse, N-HA tag MG52880-NY
GTF2B cDNA ORF Clone, Mouse, C-Myc tag MG52880-CM
GTF2B cDNA ORF Clone, Mouse, N-Myc tag MG52880-NM

GTF2B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GTF2B cDNA ORF Clone in Cloning Vector, Human HG16286-G
GTF2B cDNA ORF Clone, Human, untagged HG16286-UT
GTF2B cDNA ORF Clone, Human, C-GFPSpark® tag HG16286-ACG
GTF2B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16286-ACGLN
GTF2B cDNA ORF Clone, Human, N-GFPSpark® tag HG16286-ANG
GTF2B cDNA ORF Clone, Human, C-OFPSpark® tag HG16286-ACR
GTF2B cDNA ORF Clone, Human, N-OFPSpark® tag HG16286-ANR
GTF2B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16286-NF
GTF2B cDNA ORF Clone, Human, C-His tag HG16286-CH
GTF2B cDNA ORF Clone, Human, N-His tag HG16286-NH
GTF2B cDNA ORF Clone, Human, C-HA tag HG16286-CY
GTF2B cDNA ORF Clone, Human, N-HA tag HG16286-NY
GTF2B cDNA ORF Clone, Human, C-Myc tag HG16286-CM
GTF2B cDNA ORF Clone, Human, N-Myc tag HG16286-NM
GTF2B qPCR Primer Pairs, Human HP105040
info info
添加购物车成功! 添加购物车失败!