GRPEL1 cDNA ORF Clone, Human, C-HA tag

Cat: HG14608-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All GRPEL1 Reagents

CRO Services

Product recommended


All GRPEL1 Reagents

GRPEL1 cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
654 bp
Description
Full length Clone DNA of Human GrpE-like 1, mitochondrial (E. coli) with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GRPEL1 cDNA ORF Clone, Human, C-HA tag Alternative Names

HMGE cDNA ORF Clone, Human

GRPEL1 Background Information

Full Name
GrpE-like 1, mitochondrial (E. coli)

GRPEL1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
GRPEL1 cDNA ORF Clone in Cloning Vector, Ferret FG60054-G
GRPEL1 cDNA ORF Clone, Ferret, untagged FG60054-UT
GRPEL1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60054-ACGLN
GRPEL1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60054-ACG
GRPEL1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60054-ANG
GRPEL1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60054-ACR
GRPEL1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60054-ANR
GRPEL1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60054-CF
GRPEL1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60054-NF
GRPEL1 cDNA ORF Clone, Ferret, C-His tag FG60054-CH
GRPEL1 cDNA ORF Clone, Ferret, N-His tag FG60054-NH
GRPEL1 cDNA ORF Clone, Ferret, C-HA tag FG60054-CY
GRPEL1 cDNA ORF Clone, Ferret, N-HA tag FG60054-NY
GRPEL1 cDNA ORF Clone, Ferret, C-Myc tag FG60054-CM
GRPEL1 cDNA ORF Clone, Ferret, N-Myc tag FG60054-NM

GRPEL1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GRPEL1 cDNA ORF Clone in Cloning Vector, Rat RG84667-U
GRPEL1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84667-ACGLN

GRPEL1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GRPEL1 cDNA ORF Clone in Cloning Vector, Mouse MG53187-G
GRPEL1 cDNA ORF Clone, Mouse, untagged MG53187-UT
GRPEL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53187-ACG
GRPEL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53187-ACGLN
GRPEL1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53187-ANG
GRPEL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53187-ACR
GRPEL1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53187-ANR
GRPEL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53187-CF
GRPEL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53187-NF
GRPEL1 cDNA ORF Clone, Mouse, C-His tag MG53187-CH
GRPEL1 cDNA ORF Clone, Mouse, N-His tag MG53187-NH
GRPEL1 cDNA ORF Clone, Mouse, C-HA tag MG53187-CY
GRPEL1 cDNA ORF Clone, Mouse, N-HA tag MG53187-NY
GRPEL1 cDNA ORF Clone, Mouse, C-Myc tag MG53187-CM
GRPEL1 cDNA ORF Clone, Mouse, N-Myc tag MG53187-NM

GRPEL1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GRPEL1 cDNA ORF Clone in Cloning Vector, Human HG14608-G
GRPEL1 cDNA ORF Clone, Human, untagged HG14608-UT
GRPEL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14608-ACG
GRPEL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14608-ACGLN
GRPEL1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14608-ANG
GRPEL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14608-ACR
GRPEL1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14608-ANR
GRPEL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14608-CF
GRPEL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14608-NF
GRPEL1 cDNA ORF Clone, Human, C-His tag HG14608-CH
GRPEL1 cDNA ORF Clone, Human, N-His tag HG14608-NH
GRPEL1 cDNA ORF Clone, Human, N-HA tag HG14608-NY
GRPEL1 cDNA ORF Clone, Human, C-Myc tag HG14608-CM
GRPEL1 cDNA ORF Clone, Human, N-Myc tag HG14608-NM
GRPEL1 qPCR Primer Pairs, Human HP103242
info info
添加购物车成功! 添加购物车失败!