GPIHBP1 cDNA ORF Clone, Human, N-His tag

Cat: HG15388-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All GPIHBP1 Reagents

CRO Services

Product recommended


All GPIHBP1 Reagents

GPIHBP1 cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
555 bp
Description
Full length Clone DNA of Human glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GPIHBP1 cDNA ORF Clone, Human, N-His tag Alternative Names

GPI-HBP1 cDNA ORF Clone, Human;HYPL1D cDNA ORF Clone, Human

GPIHBP1 Background Information

Full Name
glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1

GPIHBP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GPIHBP1 cDNA ORF Clone in Cloning Vector, Mouse MG53699-U
GPIHBP1 cDNA ORF Clone, Mouse, untagged MG53699-UT
GPIHBP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53699-ACG
GPIHBP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53699-ACGLN
GPIHBP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53699-ACR
GPIHBP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53699-CF
GPIHBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53699-NF
GPIHBP1 cDNA ORF Clone, Mouse, C-His tag MG53699-CH
GPIHBP1 cDNA ORF Clone, Mouse, N-His tag MG53699-NH
GPIHBP1 cDNA ORF Clone, Mouse, C-HA tag MG53699-CY
GPIHBP1 cDNA ORF Clone, Mouse, N-HA tag MG53699-NY
GPIHBP1 cDNA ORF Clone, Mouse, C-Myc tag MG53699-CM
GPIHBP1 cDNA ORF Clone, Mouse, N-Myc tag MG53699-NM

GPIHBP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GPIHBP1 cDNA ORF Clone in Cloning Vector, Human HG15388-G
GPIHBP1 cDNA ORF Clone, Human, untagged HG15388-UT
GPIHBP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15388-ACG
GPIHBP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15388-ACGLN
GPIHBP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15388-ACR
GPIHBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15388-CF
GPIHBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15388-NF
GPIHBP1 cDNA ORF Clone, Human, C-His tag HG15388-CH
GPIHBP1 cDNA ORF Clone, Human, C-HA tag HG15388-CY
GPIHBP1 cDNA ORF Clone, Human, N-HA tag HG15388-NY
GPIHBP1 cDNA ORF Clone, Human, C-Myc tag HG15388-CM
GPIHBP1 cDNA ORF Clone, Human, N-Myc tag HG15388-NM
GPIHBP1 qPCR Primer Pairs, Human HP104012
info info
添加购物车成功! 添加购物车失败!