G6PD cDNA ORF Clone, Human, untagged

Cat: HG12021-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All G6PD Reagents

CRO Services

Product recommended


All G6PD Reagents

G6PD cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1638 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1401 C>T not causing the amino acid variation.
Description
Full length Clone DNA of Human glucose-6-phosphate dehydrogenase.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
HindIII + XbaI (6.1kb + 1.64kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

G6PD cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

G6PD cDNA ORF Clone, Human, untagged Validated Images

Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5624

G6PD cDNA ORF Clone, Human, untagged Alternative Names

G6PD1 cDNA ORF Clone, Human

G6PD Background Information

Full Name
glucose-6-phosphate dehydrogenase

G6PD cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
G6PD cDNA ORF Clone in Cloning Vector, Rat RG81135-U
G6PD cDNA ORF Clone, Rat, untagged RG81135-UT
G6PD Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81135-ACGLN
G6PD cDNA ORF Clone, Rat, C-GFPSpark® tag RG81135-ACG
G6PD cDNA ORF Clone, Rat, N-GFPSpark® tag RG81135-ANG
G6PD cDNA ORF Clone, Rat, C-OFPSpark® tag RG81135-ACR
G6PD cDNA ORF Clone, Rat, N-OFPSpark® tag RG81135-ANR
G6PD cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81135-CF
G6PD cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81135-NF
G6PD cDNA ORF Clone, Rat, C-His tag RG81135-CH
G6PD cDNA ORF Clone, Rat, N-His tag RG81135-NH
G6PD cDNA ORF Clone, Rat, C-HA tag RG81135-CY
G6PD cDNA ORF Clone, Rat, N-HA tag RG81135-NY
G6PD cDNA ORF Clone, Rat, C-Myc tag RG81135-CM
G6PD cDNA ORF Clone, Rat, N-Myc tag RG81135-NM
G6PD qPCR Primer Pairs, Rat RP301092

G6PD cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
G6PD cDNA ORF Clone in Cloning Vector, Human HG12021-G
G6PD cDNA ORF Clone, Human, C-GFPSpark® tag HG12021-ACG
G6PD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12021-ACGLN
G6PD cDNA ORF Clone, Human, N-GFPSpark® tag HG12021-ANG
G6PD cDNA ORF Clone, Human, C-OFPSpark® tag HG12021-ACR
G6PD cDNA ORF Clone, Human, N-OFPSpark® tag HG12021-ANR
G6PD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12021-CF
G6PD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12021-NF
G6PD cDNA ORF Clone, Human, C-His tag HG12021-CH
G6PD cDNA ORF Clone, Human, N-His tag HG12021-NH
G6PD cDNA ORF Clone, Human, C-HA tag HG12021-CY
G6PD cDNA ORF Clone, Human, N-HA tag HG12021-NY
G6PD cDNA ORF Clone, Human, C-Myc tag HG12021-CM
G6PD cDNA ORF Clone, Human, N-Myc tag HG12021-NM
G6PD qPCR Primer Pairs, Human HP101557
info info
添加购物车成功! 添加购物车失败!