FOXA3 cDNA ORF Clone, Human, untagged

Cat: HG14217-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All FOXA3 Reagents

CRO Services

Product recommended


All FOXA3 Reagents

FOXA3 cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1053 bp
Description
Full length Clone DNA of Human forkhead box A3.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FOXA3 cDNA ORF Clone, Human, untagged Alternative Names

FKHH3 cDNA ORF Clone, Human;HNF3G cDNA ORF Clone, Human;TCF3G cDNA ORF Clone, Human

FOXA3 Background Information

Full Name
forkhead box A3

FOXA3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FOXA3 cDNA ORF Clone in Cloning Vector, Mouse MG58545-U
FOXA3 cDNA ORF Clone, Mouse, untagged MG58545-UT
FOXA3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58545-ACGLN
FOXA3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58545-ACG
FOXA3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58545-ANG
FOXA3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58545-ACR
FOXA3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58545-ANR
FOXA3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58545-CF
FOXA3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58545-NF
FOXA3 cDNA ORF Clone, Mouse, C-His tag MG58545-CH
FOXA3 cDNA ORF Clone, Mouse, N-His tag MG58545-NH
FOXA3 cDNA ORF Clone, Mouse, C-HA tag MG58545-CY
FOXA3 cDNA ORF Clone, Mouse, N-HA tag MG58545-NY
FOXA3 cDNA ORF Clone, Mouse, C-Myc tag MG58545-CM
FOXA3 cDNA ORF Clone, Mouse, N-Myc tag MG58545-NM

FOXA3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FOXA3 cDNA ORF Clone in Cloning Vector, Human HG14217-G
FOXA3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14217-ACGLN
FOXA3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14217-ACG
FOXA3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14217-ANG
FOXA3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14217-ACR
FOXA3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14217-ANR
FOXA3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14217-CF
FOXA3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14217-NF
FOXA3 cDNA ORF Clone, Human, C-His tag HG14217-CH
FOXA3 cDNA ORF Clone, Human, N-His tag HG14217-NH
FOXA3 cDNA ORF Clone, Human, C-HA tag HG14217-CY
FOXA3 cDNA ORF Clone, Human, N-HA tag HG14217-NY
FOXA3 cDNA ORF Clone, Human, C-Myc tag HG14217-CM
FOXA3 cDNA ORF Clone, Human, N-Myc tag HG14217-NM
FOXA3 qPCR Primer Pairs, Human HP102867
info info
添加购物车成功! 添加购物车失败!