FHL1 cDNA ORF Clone, Human, C-His tag

Cat: HG14603-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FHL1 Reagents
CRO Services
Product recommended

All FHL1 Reagents
FHL1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
843 bp
Description
Full length Clone DNA of Human four and a half LIM domains 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FHL1 cDNA ORF Clone, Human, C-His tag Alternative Names
FHL-1 cDNA ORF Clone, Human;FHL1A cDNA ORF Clone, Human;FHL1B cDNA ORF Clone, Human;FLH1A cDNA ORF Clone, Human;KYOT cDNA ORF Clone, Human;SLIM cDNA ORF Clone, Human;SLIM-1 cDNA ORF Clone, Human;SLIM1 cDNA ORF Clone, Human;SLIMMER cDNA ORF Clone, Human;XMPMA cDNA ORF Clone, Human
FHL1 Background Information
Full Name
four and a half LIM domains 1

FHL1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FHL1 cDNA ORF Clone in Cloning Vector, Rat RG81446-G

FHL1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FHL1 cDNA ORF Clone in Cloning Vector, Mouse MG52921-G
FHL1 cDNA ORF Clone, Mouse, untagged MG52921-UT
FHL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52921-ACGLN
FHL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52921-ACG
FHL1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52921-ANG
FHL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52921-ACR
FHL1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52921-ANR
FHL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52921-CF
FHL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52921-NF
FHL1 cDNA ORF Clone, Mouse, C-His tag MG52921-CH
FHL1 cDNA ORF Clone, Mouse, N-His tag MG52921-NH
FHL1 cDNA ORF Clone, Mouse, C-HA tag MG52921-CY
FHL1 cDNA ORF Clone, Mouse, N-HA tag MG52921-NY
FHL1 cDNA ORF Clone, Mouse, C-Myc tag MG52921-CM
FHL1 cDNA ORF Clone, Mouse, N-Myc tag MG52921-NM

FHL1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FHL1 cDNA ORF Clone in Cloning Vector, Human HG14603-G
FHL1 cDNA ORF Clone, Human, untagged HG14603-UT
FHL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14603-ACGLN
FHL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14603-ACG
FHL1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14603-ANG
FHL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14603-ACR
FHL1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14603-ANR
FHL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14603-CF
FHL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14603-NF
FHL1 cDNA ORF Clone, Human, N-His tag HG14603-NH
FHL1 cDNA ORF Clone, Human, C-HA tag HG14603-CY
FHL1 cDNA ORF Clone, Human, N-HA tag HG14603-NY
FHL1 cDNA ORF Clone, Human, C-Myc tag HG14603-CM
FHL1 cDNA ORF Clone, Human, N-Myc tag HG14603-NM
FHL1 qPCR Primer Pairs, Human HP103237
info info
添加购物车成功! 添加购物车失败!