FGF13 cDNA ORF Clone, Human, C-HA tag

Cat: HG11134-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All FGF13 Reagents

CRO Services

Product recommended


All FGF13 Reagents

FGF13 cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
738 bp
Description
Full length Clone DNA of Human fibroblast growth factor 13 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FGF13 cDNA ORF Clone, Human, C-HA tag Alternative Names

FGF-13 cDNA ORF Clone, Human;FGF2 cDNA ORF Clone, Human;FHF-2 cDNA ORF Clone, Human;FHF2 cDNA ORF Clone, Human

FGF13 Background Information

Full Name
fibroblast growth factor 13

FGF13 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
FGF13 cDNA ORF Clone in Cloning Vector, Rhesus CG90073-G
FGF13 cDNA ORF Clone, Rhesus, untagged CG90073-UT
FGF13 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90073-ACGLN
FGF13 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90073-ACG
FGF13 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90073-ANG
FGF13 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90073-ACR
FGF13 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90073-ANR
FGF13 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90073-CF
FGF13 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90073-NF
FGF13 cDNA ORF Clone, Rhesus, C-His tag CG90073-CH
FGF13 cDNA ORF Clone, Rhesus, N-His tag CG90073-NH
FGF13 cDNA ORF Clone, Rhesus, C-HA tag CG90073-CY
FGF13 cDNA ORF Clone, Rhesus, N-HA tag CG90073-NY
FGF13 cDNA ORF Clone, Rhesus, C-Myc tag CG90073-CM
FGF13 cDNA ORF Clone, Rhesus, N-Myc tag CG90073-NM

FGF13 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FGF13 cDNA ORF Clone in Cloning Vector, Mouse MG50197-M
FGF13 cDNA ORF Clone, Mouse, untagged MG50197-UT
FGF13 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50197-ACG
FGF13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50197-ACGLN
FGF13 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50197-ACR
FGF13 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50197-CF
FGF13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50197-NF
FGF13 cDNA ORF Clone, Mouse, C-His tag MG50197-CH
FGF13 cDNA ORF Clone, Mouse, N-His tag MG50197-NH
FGF13 cDNA ORF Clone, Mouse, C-HA tag MG50197-CY
FGF13 cDNA ORF Clone, Mouse, N-HA tag MG50197-NY
FGF13 cDNA ORF Clone, Mouse, C-Myc tag MG50197-CM
FGF13 cDNA ORF Clone, Mouse, N-Myc tag MG50197-NM
FGF13 qPCR Primer Pairs, Mouse MP200227

FGF13 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FGF13 cDNA ORF Clone in Cloning Vector, Human HG11134-M
FGF13 cDNA ORF Clone, Human, untagged HG11134-UT
FGF13 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11134-ACGLN
FGF13 cDNA ORF Clone, Human, C-GFPSpark® tag HG11134-ACG
FGF13 cDNA ORF Clone, Human, N-GFPSpark® tag HG11134-ANG
FGF13 cDNA ORF Clone, Human, C-OFPSpark® tag HG11134-ACR
FGF13 cDNA ORF Clone, Human, N-OFPSpark® tag HG11134-ANR
FGF13 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11134-CF
FGF13 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11134-NF
FGF13 cDNA ORF Clone, Human, C-His tag HG11134-CH
FGF13 cDNA ORF Clone, Human, N-His tag HG11134-NH
FGF13 cDNA ORF Clone, Human, N-HA tag HG11134-NY
FGF13 cDNA ORF Clone, Human, C-Myc tag HG11134-CM
FGF13 cDNA ORF Clone, Human, N-Myc tag HG11134-NM
FGF13 qPCR Primer Pairs, Human HP101044
info info
添加购物车成功! 添加购物车失败!