Fibrinopeptide B cDNA ORF Clone, Human, C-HA tag

Cat: HG15774-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Fibrinopeptide B Reagents
CRO Services
Product recommended

All Fibrinopeptide B Reagents
Fibrinopeptide B cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1476 bp
Description
Full length Clone DNA of Human fibrinogen beta chain with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Fibrinopeptide B cDNA ORF Clone, Human, C-HA tag Alternative Names
HEL-S-78p cDNA ORF Clone, Human
Fibrinopeptide B Background Information
Full Name
fibrinogen beta chain

Fibrinopeptide B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Fibrinopeptide B cDNA ORF Clone in Cloning Vector, Rat RG80667-U
Fibrinopeptide B cDNA ORF Clone, Rat, untagged RG80667-UT
Fibrinopeptide B cDNA ORF Clone, Rat, C-GFPSpark® tag RG80667-ACG
Fibrinopeptide B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80667-ACGLN
Fibrinopeptide B cDNA ORF Clone, Rat, C-OFPSpark® tag RG80667-ACR
Fibrinopeptide B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80667-CF
Fibrinopeptide B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80667-NF
Fibrinopeptide B cDNA ORF Clone, Rat, C-His tag RG80667-CH
Fibrinopeptide B cDNA ORF Clone, Rat, N-His tag RG80667-NH
Fibrinopeptide B cDNA ORF Clone, Rat, C-HA tag RG80667-CY
Fibrinopeptide B cDNA ORF Clone, Rat, N-HA tag RG80667-NY
Fibrinopeptide B cDNA ORF Clone, Rat, C-Myc tag RG80667-CM
Fibrinopeptide B cDNA ORF Clone, Rat, N-Myc tag RG80667-NM
Fibrinopeptide B qPCR Primer Pairs, Rat RP300631

Fibrinopeptide B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Fibrinopeptide B cDNA ORF Clone in Cloning Vector, Mouse MG5A0464-U
Fibrinopeptide B cDNA ORF Clone, Mouse, untagged MG5A0464-UT
Fibrinopeptide B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0464-ACG
Fibrinopeptide B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0464-ACGLN
Fibrinopeptide B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0464-ACR
Fibrinopeptide B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0464-CF
Fibrinopeptide B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0464-NF
Fibrinopeptide B cDNA ORF Clone, Mouse, C-His tag MG5A0464-CH
Fibrinopeptide B cDNA ORF Clone, Mouse, N-His tag MG5A0464-NH
Fibrinopeptide B cDNA ORF Clone, Mouse, C-HA tag MG5A0464-CY
Fibrinopeptide B cDNA ORF Clone, Mouse, N-HA tag MG5A0464-NY
Fibrinopeptide B cDNA ORF Clone, Mouse, C-Myc tag MG5A0464-CM
Fibrinopeptide B cDNA ORF Clone, Mouse, N-Myc tag MG5A0464-NM

Fibrinopeptide B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Fibrinopeptide B cDNA ORF Clone in Cloning Vector, Human HG15774-G
Fibrinopeptide B cDNA ORF Clone, Human, untagged HG15774-UT
Fibrinopeptide B cDNA ORF Clone, Human, C-GFPSpark® tag HG15774-ACG
Fibrinopeptide B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15774-ACGLN
Fibrinopeptide B cDNA ORF Clone, Human, C-OFPSpark® tag HG15774-ACR
Fibrinopeptide B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15774-CF
Fibrinopeptide B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15774-NF
Fibrinopeptide B cDNA ORF Clone, Human, C-His tag HG15774-CH
Fibrinopeptide B cDNA ORF Clone, Human, N-His tag HG15774-NH
Fibrinopeptide B cDNA ORF Clone, Human, N-HA tag HG15774-NY
Fibrinopeptide B cDNA ORF Clone, Human, C-Myc tag HG15774-CM
Fibrinopeptide B cDNA ORF Clone, Human, N-Myc tag HG15774-NM
Fibrinopeptide B qPCR Primer Pairs, Human HP104365
info info
添加购物车成功! 添加购物车失败!