FAHD1 cDNA ORF Clone, Human, untagged

Cat: HG15239-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FAHD1 Reagents
CRO Services
Product recommended

All FAHD1 Reagents
FAHD1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
681 bp
Description
Full length Clone DNA of Human fumarylacetoacetate hydrolase domain containing 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAHD1 cDNA ORF Clone, Human, untagged Alternative Names
C16orf36 cDNA ORF Clone, Human;YISKL cDNA ORF Clone, Human
FAHD1 Background Information
Full Name
fumarylacetoacetate hydrolase domain containing 1

FAHD1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
FAHD1 cDNA ORF Clone in Cloning Vector, Rat RG81590-G

FAHD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FAHD1 cDNA ORF Clone in Cloning Vector, Mouse MG52949-G
FAHD1 cDNA ORF Clone, Mouse, untagged MG52949-UT
FAHD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52949-ACG
FAHD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52949-ACGLN
FAHD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52949-ANG
FAHD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52949-ACR
FAHD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52949-ANR
FAHD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52949-CF
FAHD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52949-NF
FAHD1 cDNA ORF Clone, Mouse, C-His tag MG52949-CH
FAHD1 cDNA ORF Clone, Mouse, N-His tag MG52949-NH
FAHD1 cDNA ORF Clone, Mouse, C-HA tag MG52949-CY
FAHD1 cDNA ORF Clone, Mouse, N-HA tag MG52949-NY
FAHD1 cDNA ORF Clone, Mouse, C-Myc tag MG52949-CM
FAHD1 cDNA ORF Clone, Mouse, N-Myc tag MG52949-NM

FAHD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FAHD1 cDNA ORF Clone in Cloning Vector, Human HG15239-G
FAHD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15239-ACGLN
FAHD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15239-ACG
FAHD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15239-ANG
FAHD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15239-ACR
FAHD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15239-ANR
FAHD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15239-CF
FAHD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15239-NF
FAHD1 cDNA ORF Clone, Human, C-His tag HG15239-CH
FAHD1 cDNA ORF Clone, Human, N-His tag HG15239-NH
FAHD1 cDNA ORF Clone, Human, C-HA tag HG15239-CY
FAHD1 cDNA ORF Clone, Human, N-HA tag HG15239-NY
FAHD1 cDNA ORF Clone, Human, C-Myc tag HG15239-CM
FAHD1 cDNA ORF Clone, Human, N-Myc tag HG15239-NM
FAHD1 qPCR Primer Pairs, Human HP103865
info info
添加购物车成功! 添加购物车失败!