MAPK6 cDNA ORF Clone, Human, untagged

Cat: HG10662-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MAPK6 Reagents

CRO Services

Product recommended


All MAPK6 Reagents

MAPK6 cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2166 bp
Description
Full length Clone DNA of Human mitogen-activated protein kinase 6.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MAPK6 cDNA ORF Clone, Human, untagged Alternative Names

ERK3 cDNA ORF Clone, Human;HsT17250 cDNA ORF Clone, Human;p97MAPK cDNA ORF Clone, Human;PRKM6 cDNA ORF Clone, Human

MAPK6 Background Information

Full Name
mitogen-activated protein kinase 6

MAPK6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MAPK6 cDNA ORF Clone in Cloning Vector, Mouse MG50847-G
MAPK6 cDNA ORF Clone, Mouse, untagged MG50847-UT
MAPK6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50847-ACG
MAPK6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50847-ACGLN
MAPK6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50847-ANG
MAPK6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50847-ACR
MAPK6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50847-ANR
MAPK6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50847-CF
MAPK6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50847-NF
MAPK6 cDNA ORF Clone, Mouse, C-His tag MG50847-CH
MAPK6 cDNA ORF Clone, Mouse, N-His tag MG50847-NH
MAPK6 cDNA ORF Clone, Mouse, C-HA tag MG50847-CY
MAPK6 cDNA ORF Clone, Mouse, N-HA tag MG50847-NY
MAPK6 cDNA ORF Clone, Mouse, C-Myc tag MG50847-CM
MAPK6 cDNA ORF Clone, Mouse, N-Myc tag MG50847-NM
MAPK6 qPCR Primer Pairs, Mouse MP200818

MAPK6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MAPK6 cDNA ORF Clone in Cloning Vector, Human HG10662-M
MAPK6 cDNA ORF Clone, Human, C-GFPSpark® tag HG10662-ACG
MAPK6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10662-ACGLN
MAPK6 cDNA ORF Clone, Human, N-GFPSpark® tag HG10662-ANG
MAPK6 cDNA ORF Clone, Human, C-OFPSpark® tag HG10662-ACR
MAPK6 cDNA ORF Clone, Human, N-OFPSpark® tag HG10662-ANR
MAPK6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10662-CF
MAPK6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10662-NF
MAPK6 cDNA ORF Clone, Human, C-His tag HG10662-CH
MAPK6 cDNA ORF Clone, Human, N-His tag HG10662-NH
MAPK6 cDNA ORF Clone, Human, C-HA tag HG10662-CY
MAPK6 cDNA ORF Clone, Human, N-HA tag HG10662-NY
MAPK6 cDNA ORF Clone, Human, C-Myc tag HG10662-CM
MAPK6 cDNA ORF Clone, Human, N-Myc tag HG10662-NM
MAPK6 qPCR Primer Pairs, Human HP100630
info info
添加购物车成功! 添加购物车失败!