ELP2/STATIP1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14313-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ELP2/STATIP1 Reagents

CRO Services

Product recommended


All ELP2/STATIP1 Reagents

ELP2/STATIP1 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2271 bp
Description
Full length Clone DNA of Human elongator acetyltransferase complex subunit 2 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ELP2/STATIP1 cDNA ORF Clone, Human, N-Myc tag Alternative Names

SHINC-2 cDNA ORF Clone, Human;STATIP1 cDNA ORF Clone, Human;StIP cDNA ORF Clone, Human

ELP2/STATIP1 Background Information

Full Name
elongator acetyltransferase complex subunit 2

ELP2/STATIP1 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
ELP2/STATIP1 cDNA ORF Clone in Cloning Vector, Rabbit TG65024-G
ELP2/STATIP1 cDNA ORF Clone, Rabbit, untagged TG65024-UT
ELP2/STATIP1 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65024-ACGLN
ELP2/STATIP1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65024-ACG
ELP2/STATIP1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65024-ANG
ELP2/STATIP1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65024-ACR
ELP2/STATIP1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65024-ANR
ELP2/STATIP1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65024-CF
ELP2/STATIP1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65024-NF
ELP2/STATIP1 cDNA ORF Clone, Rabbit, C-His tag TG65024-CH
ELP2/STATIP1 cDNA ORF Clone, Rabbit, N-His tag TG65024-NH
ELP2/STATIP1 cDNA ORF Clone, Rabbit, C-HA tag TG65024-CY
ELP2/STATIP1 cDNA ORF Clone, Rabbit, N-HA tag TG65024-NY
ELP2/STATIP1 cDNA ORF Clone, Rabbit, C-Myc tag TG65024-CM
ELP2/STATIP1 cDNA ORF Clone, Rabbit, N-Myc tag TG65024-NM

ELP2/STATIP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ELP2/STATIP1 cDNA ORF Clone in Cloning Vector, Mouse MG51454-G
ELP2/STATIP1 cDNA ORF Clone, Mouse, untagged MG51454-UT
ELP2/STATIP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51454-ACGLN
ELP2/STATIP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51454-ACG
ELP2/STATIP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51454-ANG
ELP2/STATIP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51454-ACR
ELP2/STATIP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51454-ANR
ELP2/STATIP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51454-CF
ELP2/STATIP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51454-NF
ELP2/STATIP1 cDNA ORF Clone, Mouse, C-His tag MG51454-CH
ELP2/STATIP1 cDNA ORF Clone, Mouse, N-His tag MG51454-NH
ELP2/STATIP1 cDNA ORF Clone, Mouse, C-HA tag MG51454-CY
ELP2/STATIP1 cDNA ORF Clone, Mouse, N-HA tag MG51454-NY
ELP2/STATIP1 cDNA ORF Clone, Mouse, C-Myc tag MG51454-CM
ELP2/STATIP1 cDNA ORF Clone, Mouse, N-Myc tag MG51454-NM
ELP2/STATIP1 qPCR Primer Pairs, Mouse MP201338

ELP2/STATIP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ELP2/STATIP1 cDNA ORF Clone in Cloning Vector, Human HG14313-G
ELP2/STATIP1 cDNA ORF Clone, Human, untagged HG14313-UT
ELP2/STATIP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14313-ACGLN
ELP2/STATIP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14313-ACG
ELP2/STATIP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14313-ANG
ELP2/STATIP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14313-ACR
ELP2/STATIP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14313-ANR
ELP2/STATIP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14313-CF
ELP2/STATIP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14313-NF
ELP2/STATIP1 cDNA ORF Clone, Human, C-His tag HG14313-CH
ELP2/STATIP1 cDNA ORF Clone, Human, N-His tag HG14313-NH
ELP2/STATIP1 cDNA ORF Clone, Human, C-HA tag HG14313-CY
ELP2/STATIP1 cDNA ORF Clone, Human, N-HA tag HG14313-NY
ELP2/STATIP1 cDNA ORF Clone, Human, C-Myc tag HG14313-CM
ELP2/STATIP1 qPCR Primer Pairs, Human HP102963
info info
添加购物车成功! 添加购物车失败!