EFTUD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG14427-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All EFTUD2 Reagents

CRO Services

Product recommended


All EFTUD2 Reagents

EFTUD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2919 bp
Description
Full length Clone DNA of Human elongation factor Tu GTP binding domain containing 2 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EFTUD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

MFDGA cDNA ORF Clone, Human;MFDM cDNA ORF Clone, Human;SNRNP116 cDNA ORF Clone, Human;Snrp116 cDNA ORF Clone, Human;Snu114 cDNA ORF Clone, Human;U5-116KD cDNA ORF Clone, Human

EFTUD2 Background Information

Full Name
elongation factor Tu GTP binding domain containing 2

EFTUD2 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
EFTUD2 cDNA ORF Clone in Cloning Vector, Rhesus CG90638-G
EFTUD2 cDNA ORF Clone, Rhesus, untagged CG90638-UT
EFTUD2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90638-ACG
EFTUD2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90638-ACGLN
EFTUD2 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90638-ANG
EFTUD2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90638-ACR
EFTUD2 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90638-ANR
EFTUD2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90638-CF
EFTUD2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90638-NF
EFTUD2 cDNA ORF Clone, Rhesus, C-His tag CG90638-CH
EFTUD2 cDNA ORF Clone, Rhesus, N-His tag CG90638-NH
EFTUD2 cDNA ORF Clone, Rhesus, C-HA tag CG90638-CY
EFTUD2 cDNA ORF Clone, Rhesus, N-HA tag CG90638-NY
EFTUD2 cDNA ORF Clone, Rhesus, C-Myc tag CG90638-CM
EFTUD2 cDNA ORF Clone, Rhesus, N-Myc tag CG90638-NM

EFTUD2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EFTUD2 cDNA ORF Clone in Cloning Vector, Human HG14427-G
EFTUD2 cDNA ORF Clone, Human, untagged HG14427-UT
EFTUD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14427-ACGLN
EFTUD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14427-ACG
EFTUD2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14427-ANG
EFTUD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14427-ACR
EFTUD2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14427-ANR
EFTUD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14427-NF
EFTUD2 cDNA ORF Clone, Human, C-His tag HG14427-CH
EFTUD2 cDNA ORF Clone, Human, N-His tag HG14427-NH
EFTUD2 cDNA ORF Clone, Human, C-HA tag HG14427-CY
EFTUD2 cDNA ORF Clone, Human, N-HA tag HG14427-NY
EFTUD2 cDNA ORF Clone, Human, C-Myc tag HG14427-CM
EFTUD2 cDNA ORF Clone, Human, N-Myc tag HG14427-NM
EFTUD2 qPCR Primer Pairs, Human HP103076
info info
添加购物车成功! 添加购物车失败!