EDDM3B cDNA ORF Clone, Human, N-Myc tag

Cat: HG13739-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EDDM3B Reagents
CRO Services
Product recommended

All EDDM3B Reagents
EDDM3B cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
444 bp
Description
Full length Clone DNA of Human epididymal protein 3B with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EDDM3B cDNA ORF Clone, Human, N-Myc tag Alternative Names
EP3B cDNA ORF Clone, Human;FAM12B cDNA ORF Clone, Human;HE3-BETA cDNA ORF Clone, Human;HE3B cDNA ORF Clone, Human;RAM2 cDNA ORF Clone, Human
EDDM3B Background Information
Full Name
epididymal protein 3B

EDDM3B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EDDM3B cDNA ORF Clone in Cloning Vector, Human HG15930-G
EDDM3B cDNA ORF Clone in Cloning Vector, Human HG13739-G
EDDM3B cDNA ORF Clone, Human, untagged HG13739-UT
EDDM3B cDNA ORF Clone, Human, untagged HG15930-UT
EDDM3B cDNA ORF Clone, Human, C-GFPSpark® tag HG15930-ACG
EDDM3B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15930-ACGLN
EDDM3B cDNA ORF Clone, Human, C-GFPSpark® tag HG13739-ACG
EDDM3B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13739-ACGLN
EDDM3B cDNA ORF Clone, Human, C-OFPSpark® tag HG15930-ACR
EDDM3B cDNA ORF Clone, Human, C-OFPSpark® tag HG13739-ACR
EDDM3B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15930-CF
EDDM3B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13739-CF
EDDM3B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13739-NF
EDDM3B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15930-NF
EDDM3B cDNA ORF Clone, Human, C-His tag HG13739-CH
EDDM3B cDNA ORF Clone, Human, C-His tag HG15930-CH
EDDM3B cDNA ORF Clone, Human, N-His tag HG15930-NH
EDDM3B cDNA ORF Clone, Human, N-His tag HG13739-NH
EDDM3B cDNA ORF Clone, Human, C-HA tag HG13739-CY
EDDM3B cDNA ORF Clone, Human, C-HA tag HG15930-CY
EDDM3B cDNA ORF Clone, Human, N-HA tag HG15930-NY
EDDM3B cDNA ORF Clone, Human, N-HA tag HG13739-NY
EDDM3B cDNA ORF Clone, Human, C-Myc tag HG13739-CM
EDDM3B cDNA ORF Clone, Human, C-Myc tag HG15930-CM
EDDM3B cDNA ORF Clone, Human, N-Myc tag HG15930-NM
EDDM3B qPCR Primer Pairs, Human HP102416
info info
添加购物车成功! 添加购物车失败!