EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15651-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EDA-A1/Ectodysplasin-A1 Reagents
CRO Services
Product recommended

All EDA-A1/Ectodysplasin-A1 Reagents
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1176 bp
Description
Full length Clone DNA of Human ectodysplasin A with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
ECTD1 cDNA ORF Clone, Human;ED1 cDNA ORF Clone, Human;ED1-A1 cDNA ORF Clone, Human;ED1-A2 cDNA ORF Clone, Human;EDA-A1 cDNA ORF Clone, Human;EDA-A2 cDNA ORF Clone, Human;EDA1 cDNA ORF Clone, Human;EDA2 cDNA ORF Clone, Human;HED cDNA ORF Clone, Human;HED1 cDNA ORF Clone, Human;ODT1 cDNA ORF Clone, Human;STHAGX1 cDNA ORF Clone, Human;XHED cDNA ORF Clone, Human;XLHED cDNA ORF Clone, Human
EDA-A1/Ectodysplasin-A1 Background Information
Full Name
ectodysplasin A

EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone in Cloning Vector, Human HG10191-M
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone in Cloning Vector, Human HG15651-G
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, untagged HG10191-UT
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, untagged HG15651-UT
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10191-ACG
EDA-A1/Ectodysplasin-A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10191-ACGLN
EDA-A1/Ectodysplasin-A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15651-ACGLN
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15651-ACG
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10191-ACR
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15651-ACR
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10191-CF
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15651-NF
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10191-NF
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, C-His tag HG10191-CH
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, C-His tag HG15651-CH
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, N-His tag HG10191-NH
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, N-His tag HG15651-NH
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, C-HA tag HG10191-CY
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, C-HA tag HG15651-CY
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, N-HA tag HG10191-NY
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, N-HA tag HG15651-NY
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, C-Myc tag HG15651-CM
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, C-Myc tag HG10191-CM
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, N-Myc tag HG15651-NM
EDA-A1/Ectodysplasin-A1 cDNA ORF Clone, Human, N-Myc tag HG10191-NM
EDA-A1/Ectodysplasin-A1 qPCR Primer Pairs, Human HP100257
info info
添加购物车成功! 添加购物车失败!