emopamil binding protein cDNA ORF Clone, Human, N-HA tag

Cat: HG16409-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All emopamil binding protein Reagents

CRO Services

Product recommended


All emopamil binding protein Reagents

emopamil binding protein cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
693 bp
Description
Full length Clone DNA of Human emopamil binding protein (sterol isomerase) with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

emopamil binding protein cDNA ORF Clone, Human, N-HA tag Alternative Names

CDPX2 cDNA ORF Clone, Human;CHO2 cDNA ORF Clone, Human;CPX cDNA ORF Clone, Human;CPXD cDNA ORF Clone, Human;MEND cDNA ORF Clone, Human

emopamil binding protein Background Information

Full Name
emopamil binding protein (sterol isomerase)

emopamil binding protein cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
emopamil binding protein cDNA ORF Clone in Cloning Vector, Mouse MG5A0318-U
emopamil binding protein cDNA ORF Clone, Mouse, untagged MG5A0318-UT
emopamil binding protein cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0318-ACG
emopamil binding protein Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0318-ACGLN
emopamil binding protein cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0318-ANG
emopamil binding protein cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0318-ACR
emopamil binding protein cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0318-ANR
emopamil binding protein cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0318-CF
emopamil binding protein cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0318-NF
emopamil binding protein cDNA ORF Clone, Mouse, C-His tag MG5A0318-CH
emopamil binding protein cDNA ORF Clone, Mouse, N-His tag MG5A0318-NH
emopamil binding protein cDNA ORF Clone, Mouse, C-HA tag MG5A0318-CY
emopamil binding protein cDNA ORF Clone, Mouse, N-HA tag MG5A0318-NY
emopamil binding protein cDNA ORF Clone, Mouse, C-Myc tag MG5A0318-CM
emopamil binding protein cDNA ORF Clone, Mouse, N-Myc tag MG5A0318-NM

emopamil binding protein cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
emopamil binding protein cDNA ORF Clone in Cloning Vector, Human HG16409-G
emopamil binding protein cDNA ORF Clone, Human, untagged HG16409-UT
emopamil binding protein Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16409-ACGLN
emopamil binding protein cDNA ORF Clone, Human, C-GFPSpark® tag HG16409-ACG
emopamil binding protein cDNA ORF Clone, Human, N-GFPSpark® tag HG16409-ANG
emopamil binding protein cDNA ORF Clone, Human, C-OFPSpark® tag HG16409-ACR
emopamil binding protein cDNA ORF Clone, Human, N-OFPSpark® tag HG16409-ANR
emopamil binding protein cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16409-CF
emopamil binding protein cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16409-NF
emopamil binding protein cDNA ORF Clone, Human, C-His tag HG16409-CH
emopamil binding protein cDNA ORF Clone, Human, N-His tag HG16409-NH
emopamil binding protein cDNA ORF Clone, Human, C-HA tag HG16409-CY
emopamil binding protein cDNA ORF Clone, Human, C-Myc tag HG16409-CM
emopamil binding protein cDNA ORF Clone, Human, N-Myc tag HG16409-NM
emopamil binding protein qPCR Primer Pairs, Human HP105158
info info
添加购物车成功! 添加购物车失败!