Desmoglein-2 cDNA ORF Clone, Human, N-His tag

Cat: HG13684-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Desmoglein-2 Reagents
CRO Services
Product recommended

All Desmoglein-2 Reagents
Desmoglein-2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3357 bp
Description
Full length Clone DNA of Human desmoglein 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Desmoglein-2 cDNA ORF Clone, Human, N-His tag Alternative Names
ARVC10 cDNA ORF Clone, Human;ARVD10 cDNA ORF Clone, Human;CDHF5 cDNA ORF Clone, Human;CMD1BB cDNA ORF Clone, Human;HDGC cDNA ORF Clone, Human
Desmoglein-2 Background Information
Full Name
desmoglein 2

Desmoglein-2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Desmoglein-2 cDNA ORF Clone in Cloning Vector, Mouse MG51150-G
Desmoglein-2 cDNA ORF Clone, Mouse, untagged MG51150-UT
Desmoglein-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51150-ACGLN
Desmoglein-2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51150-ACG
Desmoglein-2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51150-ACR
Desmoglein-2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51150-CF
Desmoglein-2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51150-NF
Desmoglein-2 cDNA ORF Clone, Mouse, C-His tag MG51150-CH
Desmoglein-2 cDNA ORF Clone, Mouse, N-His tag MG51150-NH
Desmoglein-2 cDNA ORF Clone, Mouse, C-HA tag MG51150-CY
Desmoglein-2 cDNA ORF Clone, Mouse, N-HA tag MG51150-NY
Desmoglein-2 cDNA ORF Clone, Mouse, C-Myc tag MG51150-CM
Desmoglein-2 cDNA ORF Clone, Mouse, N-Myc tag MG51150-NM

Desmoglein-2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Desmoglein-2 cDNA ORF Clone in Cloning Vector, Human HG13684-G
Desmoglein-2 cDNA ORF Clone, Human, untagged HG13684-UT
Desmoglein-2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13684-ACGLN
Desmoglein-2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13684-ACG
Desmoglein-2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13684-ACR
Desmoglein-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13684-CF
Desmoglein-2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13684-NF
Desmoglein-2 cDNA ORF Clone, Human, C-His tag HG13684-CH
Desmoglein-2 cDNA ORF Clone, Human, C-HA tag HG13684-CY
Desmoglein-2 cDNA ORF Clone, Human, N-HA tag HG13684-NY
Desmoglein-2 cDNA ORF Clone, Human, C-Myc tag HG13684-CM
Desmoglein-2 cDNA ORF Clone, Human, N-Myc tag HG13684-NM
Desmoglein-2 qPCR Primer Pairs, Human HP102363
info info
添加购物车成功! 添加购物车失败!