DPCD cDNA ORF Clone, Human, C-His tag

Cat: HG14594-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All DPCD Reagents

CRO Services

Product recommended


All DPCD Reagents

DPCD cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
612 bp
Description
Full length Clone DNA of Human deleted in primary ciliary dyskinesia homolog (mouse) with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DPCD Background Information

Full Name
deleted in primary ciliary dyskinesia homolog (mouse)

DPCD cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DPCD cDNA ORF Clone in Cloning Vector, Mouse MG53340-U
DPCD cDNA ORF Clone, Mouse, untagged MG53340-UT
DPCD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53340-ACG
DPCD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53340-ACGLN
DPCD cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53340-ANG
DPCD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53340-ACR
DPCD cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53340-ANR
DPCD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53340-CF
DPCD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53340-NF
DPCD cDNA ORF Clone, Mouse, C-His tag MG53340-CH
DPCD cDNA ORF Clone, Mouse, N-His tag MG53340-NH
DPCD cDNA ORF Clone, Mouse, C-HA tag MG53340-CY
DPCD cDNA ORF Clone, Mouse, N-HA tag MG53340-NY
DPCD cDNA ORF Clone, Mouse, C-Myc tag MG53340-CM
DPCD cDNA ORF Clone, Mouse, N-Myc tag MG53340-NM

DPCD cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DPCD cDNA ORF Clone in Cloning Vector, Human HG14594-G
DPCD cDNA ORF Clone, Human, untagged HG14594-UT
DPCD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14594-ACGLN
DPCD cDNA ORF Clone, Human, C-GFPSpark® tag HG14594-ACG
DPCD cDNA ORF Clone, Human, N-GFPSpark® tag HG14594-ANG
DPCD cDNA ORF Clone, Human, C-OFPSpark® tag HG14594-ACR
DPCD cDNA ORF Clone, Human, N-OFPSpark® tag HG14594-ANR
DPCD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14594-CF
DPCD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14594-NF
DPCD cDNA ORF Clone, Human, N-His tag HG14594-NH
DPCD cDNA ORF Clone, Human, C-HA tag HG14594-CY
DPCD cDNA ORF Clone, Human, N-HA tag HG14594-NY
DPCD cDNA ORF Clone, Human, C-Myc tag HG14594-CM
DPCD cDNA ORF Clone, Human, N-Myc tag HG14594-NM
DPCD qPCR Primer Pairs, Human HP103228
info info
添加购物车成功! 添加购物车失败!